Overview

Sheet 1: Suppl Tab1

Acta Biochimica Polonica
Suplementary Materials	Epub: No 2016_1346;	Vol. 63, 2016	https://doi.org/10.18388/abp.2016_
Participation of non-coding RNAs in plant organelle biogenesis
Michał Rurek

Supplementary Table 1. List of the identified plant intraorganellar ncRNAs.

Plant material	Organellar genome	ncRNAs	Source/ technique	Name/ annotation	RNA size (nt)	Comments on relative abundance	Description of mapped sequences/ other comments	Reference
Arabidopsis thaliana seedlings, adult plants and 2 intermediate stages	mitochondrial	small non-messenger RNA	cDNA library from RNAs sized 50-500 nt, Northern	Ath-290 [AJ505722]	300	low	orf110b-orf25 intergenic region	Marker et al. (2002)
				Ath-59 [AJ505721]	62, 79, 170	very high	repeat unit, cox2-orf139a and orf161-orf139b intergenic regions
				Ath-377 [AJ505723]	255	low	homolog in B. oleracea (100%), orfB-orf107c and orf313-orf106c intergenic regions
				Ath-647 [AJ505724]	162	low	repeat unit, nad1-trnS and trnS-orf106 intergenic regions, homolog in B. oleracea (98%)
				Ath-241 [AJ505738]	72, 162	low	nad1ex5 (NP085565.1)
	plastid			Ath-230 [AJ505725]	290	low	intergenic region trnL-trnF, homolog in P. micrantha (93%) and P. fremontii (93%)
				Ath-243 [AJ505726]	55	low	rrn5-rrn4.5 intergenic region, homolog in B. napus (99%)
				Ath-270 [AJ505727]	162	low	psbJ-psbL intergenic region, homolog in B. oleracea (97%)
				Ath-310 [AJ505728]	55	high	psbA-trnK intergenic region
				Ath-587 [AJ505729]	95	high	psaC-ndhE intergenic region
				Ath-602 [AJ505732]	160	high	petD intron
				Ath-328 [AJ505741]	50	high	rbcL 3' UTR (AAF35257.1)
Arabidopsis thaliana seedling/cell culture 'Col' with downregulated mt PNPase gene (At5g14580)	mitochondrial	asRNA	cDNA SMART synthesis assay, polyadenylated RNA library sized 100-150 nt, degradation tag analysis		100-150	very low (by Northern) for asRNA to the known gene messengers	500 nt transcript generated from the repeat I of the mt genome and mRNAs for the numerous known genes (atp9 asRNA and for nad4, nad5, nad7 with promoters driving asRNA synthesis)	Holec et al. (2006)
Arabidopsis thaliana seedlings	plastid	asRNA	cRT-PCR, 5'RACE, TAP-5'RACE, Northern	psbTas	186	lower at photooxidative stress	5'UTR-psbT-3'UTR	Zghidi-Abouzid et al. (2011)
leaves, roots, flowers/ buds and 14-d-old seedlings of Arabidopsis thaliana'Col' WT and 3 mutant lines: rnr1-3 (SALK_090294), pnp1-1 (SALK_013306), and 1-1 (SALK_093546)	plastid	asRNA	cRT-PCR, RT-PCR, Northern	AS5	three species: 398, 440, 474	highest in seedlings, leaves and floral buds	rrn5-trnR intergenic region	Sharwood et al. (2015)
Nicotiana tabacum cv. petite Havana seedlings, asRNA overexpression	plastid	asRNA	chloroplast transformation, RT-PCR, Northern	AS5	450	very high in mature leaves	rrn5-trnR intergenic region; overexpression of AS5 is associated with the decreased 5S rRNA stability	Hotto et al. (2010)
mature leaves of Arabidopsis thaliana 'Col' WT and 3 mutant lines: pnp1-1 (SALK_013306), rnr1-3 (SALK_090294), and rne1-1 (SALK_093546)	plastid	asRNA	RT-PCR, Northern, RNA-seq	1	1600, 1800	moderate, lower in pnp mutant	trnH	Hotto et al. (2011)
		asRNA	RT-PCR, RNA-seq	2		very low	matK
		asRNA	RT-PCR, Northern, RNA-seq	3	1300, 800	very low, very high (additional species) in pnp mutant	rps16
		asRNA	RT-PCR,Northern, RNA-seq	4	1300, 1100, 800	very low, additional Northern bands in pnp mutant	rps16i-1
		asRNA	RNA-seq	5		very low, additional Northern bands in pnp mutant	rps16i-2
		asRNA	RT-PCR, Northern, RNA-seq	6	1200, 1000	low, higher in pnp mutant	trnQ
		asRNA	RT-PCR, Northern, RNA-seq	7	1002, 3300, 3400	very high	psbK
		asRNA	Northern, RNA-seq	8			psbI
		asRNA	RT-PCR, Northern, RNA-seq	9	1800, 3000, 3200		trnS.1
		asRNA	RT-PCR, Northern, RNA-seq	10	1100, 1800	very low, higher accumulation (additional species) in pnp mutant	trnG-5'
		asRNA	RT-PCR, RNA-seq	11		very low, higher accumulation (additional species) in pnp mutant	trnG-3'
		asRNA	RT-PCR, Northern, RNA-seq	12	200, 300	relatively high	trnR.1
		asRNA	RNA-seq	13			atpA
		asRNA	RT-PCR, Northern, RNA-seq	14	600, 1000	moderate	atpI
		asRNA	RNA-seq	15			rpoC2-1
		asRNA	RNA-seq	16			rpoC2-2
		asRNA	RT-PCR, Northern, RNA-seq	17	600, 1100, 1700	very low, higher accumulation (additional species) in pnp mutant	trnC
		ncRNA	RT-PCR, RNA-seq	18		very low, higher accumulation (additional species) in pnp mutant	trnC-ycf6 intergenic region
		asRNA	RNA-seq	19			trnD
		ncRNA	RNA-seq	20			trnD-trnY intergenic region
		asRNA	RT-PCR, RNA-seq	21		very low, very high in pnp mutant	trnT.1
		asRNA	RT-PCR, RNA-seq	22		extremely low	psbD
		asRNA	RT-PCR, Northern, RNA-seq	23	3300, 3400	low, higher accumulation (additional species) in pnp mutant	trnS.2
		asRNA	Rt-PCR, Northern, RNA-seq	24	300, 900, 2000	low, higher accumulation (additional species) in pnp mutant	ycf9
		asRNA	RT-PCR, Northern, RNA-seq	25	100, 300, 400	high	trnfM
		asRNA	RNA-seq	26			rps14-psaB intergenic region
		ncRNA	RT-PCR, RNA-seq	27		extremely low	ycf3-3'
		asRNA	RT-PCR, Northern, RNA-seq	28	1100	low, higher in pnp mutant	trnS.3
		asRNA	RT-PCR, Northern, RNA-seq	29	1900	moderate	rps4-3'
		asRNA	RNA-seq	30			rps4-5'
		asRNA	RNA-seq	31			trnT.2
		asRNA	RNA-seq	32			trnL-3'
		asRNA	RT-PCR, RNA-seq	33		low	ndhK
		asRNA	RT-PCR, RNA-seq	34		low, higher in pnp mutant	ndhC-5'
		ncRNA	RT-PCR, RNA-seq	35		low, higher in pnp mutant	ndhC-trnV.1 intergenic region
		asRNA	RNA-seq	36			trnVi
		asRNA	RNA-seq	37			trnM
		ncRNA	RT-PCR, Northern, RNA-seq	38	500, 600, 1000	very high, lower in pnp mutant	rbcL-accD intergenic region
		asRNA	RT-PCR, Northern, RNA-seq	39	700, 800, 1000, 1900	moderate	accD
		ncRNA	RT-PCR, Northern, RNA-seq	40	1100, 1800	low, higher in pnp mutant	accD-psaI intergenic region
		ncRNA	RNA-seq	41		low, higher in pnp mutant	accD-psaI intergenic region
		asRNA	RT-PCR, RNA-seq	42		extremely low	ycf10-5'
		asRNA	RT-PCR, Northern, RNA-seq	43	1300, 1700, 1800	low, higher in pnp mutant	ycf10
		ncRNA	RT-PCR, Northern, RNA-seq	44	1000, 1600, 1800	low, higher in pnp mutant	ycf10-petA intergenic region
		asRNA	RT-PCR, Northern, RNA-seq	45	500, 1700	moderate, lower in pnp mutant	petA
		asRNA	RNA-seq	46			psbJ
		asRNA	RNA-seq	47			psbL-psbF
		asRNA	RT-PCR, RNA-seq	48		low	orf31
		asRNA	RT-PCR, Northern, RNA-seq	49	900, 1300, 1800	high, lower in pnp mutants (additional species)	trnW
		asRNA	RT-PCR, Northern, RNA-seq	50	1000, 1100	moderate, lower in pnp mutant	trnP
		asRNA	RNA-seq	51			psaJ
		ncRNA	RT-PCR, Northern, RNA-seq	52	300, 700, 1300, 1400	moderate, lower in pnp mutant (additional species)	psaJ-rpl33 intergenic region
		asRNA	RT-PCR, Northern, RNA-seq	53	700, 1300, 1400, 2700, 3100	high, lower in pnp mutant (additional species)	rpl33
		asRNA	RT-PCR, Northern, RNA-seq	54	1000, 1400, 1900, 3000	moderate, lower in pnp mutant (additional species)	rps18
		asRNA	RNA-seq	55			rpl20
		asRNA	RT-PCR, Northern, RNA-seq	56	1700	very low, more higher accumulated Northern bands in pnp mutant	psbB
		ncRNA	RT-PCR, Northern, RNA-seq	57	600	very low, very high accumulation (additional species) in pnp mutant	psbB-psbT intergenic region
		asRNA	RNA-seq	58			psbT
		asRNA	RT-PCR, Northern, RNA-seq	59	2000, 3300, 3500	moderate, very high accumulation (additional species) in pnp mutant	psbN
		asRNA	RT-PCR, Northern, RNA-seq	60	1100, 1900	moderate, lower accumulation (additional species) in pnp mutant	psbH
		asRNA	RT-PCR, RNA-seq	61		very low	petBi
		asRNA	RT-PCR, RNA-seq	62		low	petD-3'
		asRNA	RT-PCR, RNA-seq	63		extremely low, high accumulation in pnp mutant	rpoA-3'
		asRNA	RNA-seq	64			rpoA
asRNA	RT-PCR, RNA-seq	65		extremely low	rpoA-5'
asRNA	RNA-seq	66			rps11
asRNA	RNA-seq	67			rpl36
asRNA	RNA-seq	68			rpl14
asRNA	RNA-seq	69			rpl2i
asRNA	RT-PCR, Northern, RNA-seq	70	300	low, higher accumulation in pnp mutant	trnI.1
asRNA	RT-PCR, Northern, RNA-seq	71	700	low, moderate accumulation in pnp mutant	ycf2.1-1
asRNA	RT-PCR, RNA-seq	72		very low, moderate accumulation in pnp mutant	ycf2.1-2
asRNA	RT-PCR, RNA-seq	73		extremely low	ycf2.1-3
asRNA	RT-PCR, RNA-seq	74		extremely low	ycf2.1-4
asRNA	RT-PCR, Northern, RNA-seq	75	1000	moderate, lower accumulation in pnp mutant	ycf2.1-5
asRNA	RT-PCR, RNA-seq	76		very low, moderate accumulation in pnp mutant	ycf2.1-6
asRNA	RT-PCR, RNA-seq	77		extremely low	ycf2.1-7
asRNA	RT-PCR, Northern, RNA-seq	78	1800, 3700	low, higher accumulation in pnp mutant	ycf2.1-8
asRNA	RT-PCR, Northern, RNA-seq	79	1200	moderate, higher accumulation in pnp mutant	ycf2.1-9
asRNA	RT-PCR, RNA-seq	80		extremely low	ycf2.1-10
ncRNA	RT-PCR, Northern, RNA-seq	81	400, 1700, 3700		trnL-ndhB intergenic region
asRNA	RT-PCR, RNA-seq	82		extremely low	ndhB-3'
asRNA	RNA-seq	83			ndhBi
asRNA	RNA-seq	84			rps12-5'
ncRNA	RT-PCR, RNA-seq	85		extremely low	rrn4.5-rrn5 intergenic region
asRNA	RNA-seq	86			ycf1.1-1
asRNA	RT-PCR, Northern, RNA-seq	87	800, 900, 1300, 3300	moderate, higher accumulation in pnp mutant	ycf1.1-2
asRNA	RNA-seq	88			ndhF-3'
asRNA	RT-PCR, Northern, RNA-seq	89	1700, 1800, 3800	moderate	ndhF-5'-1
asRNA	RT-PCR, Northern, RNA-seq	90	1650, 1700	relatively high, lower in pnp mutant	ndhF-5'-2
asRNA	RNA-seq	91			ycf5-1
asRNA	RT-PCR, RNA-seq	92		extremely low	ycf5-2
asRNA	RT-PCR, Northern, RNA-seq	93	1600	moderate, lower accumulation in pnp mutant (additional species)	ndhD-1
asRNA	RT-PCR, Northern, RNA-seq	94	1300	high	ndhD-2
asRNA	RT-PCR, RNA-seq	95		low	ndhD-3
asRNA	RNA-seq	96			ndhD-4
asRNA	RNA-seq	97			ndhA-3'
asRNA	RT-PCR, RNA-seq	98		very low, higher accumulation (additional species) in pnp mutant	ndhAi
asRNA	RNA-seq	99			ndhAi-2
asRNA	RNA-seq	100			ndhA-5'
asRNA	RNA-seq	101			ycf1.2-1
asRNA	RNA-seq	192			ycf1.2-2
asRNA	RNA-seq	103			ycf1.2-3
asRNA	RT-PCR, Northern, RNA-seq	104	2000	high, very high (additional Northern bands) in pnp mutant	ycf1.2-4
asRNA	RT-PCR, RNA-seq	105		high, very low accumulation in pnp mutant	ycf1.2-5
asRNA	RNA-seq	106			ycf1.2-6
asRNA	RNA-seq	107			ycf1.2-7
Arabidopsis thaliana 'Col' seedlings, rosette leaves, ﬂower buds and siliques	plastid	sRNA	small RNA cDNA library, 5'-RACE, RNase protection, diverse deep-sequencing approaches including pyrosequencing	1	19		psbA 5‘	Ruwe & Schmitz-Linneweber (2012); Rajagopalan et al. (2006)
				2	23		psbK-psbI integenic region
				3	25		atpH-atpF intergenic region
				4	25		atpH 5'
				5	21		atpI 5‘
				6	19		rpoC1-rpoC2 intergenic region
				7	26	high	psbD-psbC intergenic region
				8	26		rps14 5'
				9	26	very high	ycf3 5'
				10	22		atpB 5'
				11	25		rbcL 5‘
				12	26	high	psaI 3‘
				13	27		petA 5‘
				14	17		psbJ 3‘
				15	24	high	petL 5‘
				16	22		as_petG 3'
				17	23		rps18 3‘
				18	27		rps12 5‘
				19	27		clpP 3‘
				20	21		psbH 5‘
				21	21	high	psbH-petB intergenic region; homolog in N. tabacum (Ntc-1)
				22	22		as_petDin
				23	21		rpoA CDS
				24	21		as_rpl16in
				25	22	high	rpl2 5‘
				26	23		ycf2 5‘
				27	24		ycf2 3‘
				28	22	very high	rps7-ndhB; homolog in N. tabacum (Ntc-2)
				29	18		rrn16 5‘ (1)
				30	20		rrn16 5‘ (2)
				31	24		rrn16-trnI
				32	19		trnIin (1)
				33	26		trnIin (2)
				34	18		trnIin (3)
				35	21		trnAin
				36	25	high	trnA-rrn23 intergenic region
				37	19		trnN 5‘
				38	22		ndhF 3‘
				39	27	high	ndhE-psaC intergenic region; homolog in N. tabacum (Ntc-8)
				40	21		ndhA 5‘
				41	24		rps15 5‘
Oryza sativa leaves and inflorescences				1	23		psbA 5'
				2	25	very high	rps16 3'
				3	23		rps16 5'
				4	26		psbD CDS
				5	22		psbD-psbC intergenic region
				6	24		trnM 5'
				7	25		rpoB 5'
				8	21		as_rpoC2
				9	24		atpH 5'
				10	21	high	atpF CDS
				11	21		atpA CDS
				12	22	high	ndhJ 3' (2)
				13	25		trnV-ndhC intergenic region
				14	27		atpB-atpE intergenic region
				15	20		rbcL 5' (1)
				16	24		rbcL 5' (2)
				17	19		rbcL 3'
				18	25		cemA CDS
				19	24		psbJ 3' (1)
				20	22		psbJ 3' (2)
				21	25		psbE 5' (2)
				22	24		petL 5'
				23	27		rps12 5'
	24	22		psbH 5' (1)
	25	20		psbH 5' (2)
	26	23		psbH CDS
	27	21	high	psbH-petB intergenic region
	28	28	high	petB-petD intergenic region
	29	25		petD 3'
	30	23		ndhB 3'
	31	23		rps7-ndhB intergenic region
	32	20		rrn16 5'
	33	25		rrn16-trnI intergenic region
	34	24		trnIin (2)
	35	24		trnAin (2)
	36	25		trnA-rrn23 (2) intergenic region
	37	20		trnR-ORF23 intergenic region
	38	23		ORF23 3'
Arabidopsis thaliana cv 'Ler' roots, whole seedlings, stems, rosette leaves, flower/inflorescences, and siliques	plastid	im-ncRNA	total RNA pooled from all tissues used, anion column-based size selection of im-ncRNA, ncRNA cDNA library, deep sequencing (454 Life Sciences platform)	nc2063	150		petN-psbM intergenic region	Wang et al. (2014)
				nc2067	164		trnT-psbD intergenic region
				nc2073	92		psbC CDS
				nc2077	170		psbC CDS 3' part, psbC-trnS intergenic region
				nc2081	88		trnG-trnS intergenic region
				nc2091	50		rbcL CDS 5' part
				nc2094	381		rbcL CDS 3' part, rbcL-accD intergenic region
				nc2110	126		petA-psbJ intergenic region
				nc2111	120		petA-psbJ intergenic region
				nc2114	113		petL-petG intergenic region, petG CDS 5' part
				nc2121	140		clpP-psbB intergenic region
				nc2134	101		petBex2 3'part
				nc2140	73		petDex2 3' part
				nc2142	123		petDex2 3' part, petD-rpoA intergenic region
				nc2149	187		trnIex1-trnIin1 region
				nc2151	64		trnI-trnA intergenic region
				nc2152	219		trnAin1
				nc2154	74		trnA-rrn23 intergenic region
				nc2156	159		rrn4.5-trnR intergenic region
				nc2160	123		rpl32-trnL intergenic region
				nc2167	146		ycf1-trnN intergenic region
				nc2171	52		rps12in1
				nc2176	112		rps7 CDS
				nc2179	96		ndhBex1
				nc2186	90		ycf2 CDS
				nc2189	61		rpl2ex1
				nc4208	114		trnG-trnR intergenic region, trnR CDS 5' part
				nc4213	61		atpA CDS
				nc4215	108		atpA CDS
				nc4220	124		atpFex1
				nc4234	224		rps14-trnfM intergenic region, rps14 CDS 3' part
				nc4244	63		psaB CDS
				nc4256	130		psaA CDS
				nc4259	98		ycf3-psaA intergenic region
				nc4259	70		ycf3-psaA intergenic region
				nc4284	180		petA-psbJ intergenic region, psbJ CDS 3' part
				nc4292	124		clpPex3, clpP-psbB intergenic region
				nc4294	202		psbN containing region
				nc4295	63		close to rpoA 3' flanking region
				nc4308	60		rpl2ex1
				nc4311	90		rps12in2
				nc4318	96		ndhBex1, rps12in2
				nc4321	112		rps7 CDS, rps12in2
				nc4326	52		rps12 5' flanking region
				nc4330	146		trnN 5' flanking region
				nc4338	83		ndhD CDS
				nc4343	132		ndhE-psaC intergenic region
				nc4345	107		ndhE CDS and CDS 5' flanking region
				nc4349	57		ndhAex2
				nc4358	159		rrn4.5-rrn5 intergenic region
				nc4360	74		trnA-rrn23 intergenic region
				nc4362	219		trnAin1
				nc4363	64		trnI-trnA intergenic region
				nc4365	187		trnIin1
	mitochondrial			nc2191	79		repeat I
				nc2192	102		repeat I
				nc2202	111		cob CDS and CDS 3' flanking region
				nc2206	73		repeat II, trnY 5' flanking region
				nc2217	93		atp6-1 CDS, atp6-1/trnS intergenic region
				nc2218	101		trnS-orf106a intergenic region
				nc2223	151		orfB CDS and CDS 3' flanking region
				nc2232	143		rpl2ex2 and CDS 3' flanking region
				nc2233	105		orfX CDS
				nc2242	65		nad4in3
nc2243		114	nad4ex4 and 3' flanking region
nc2244		100	orf313 CDS and CDS 3' flanking region
nc2245		151	orf313 3' flanking region
nc2246		79	orf139b 5' flanking region (1)
nc2247		102	orf139b 5' flanking region (2)
nc2248		126	cox3 CDS
nc2252		73	trnY 5' flanking region
nc2253		73	orf187 3' distant region
nc2255		99	atp9 CDS
nc2256		189	atp9 3' flanking region
nc2260		106	orf262 CDS and CDS 3' flanking region
nc2261		111	orf262-orf105a intergenic region
nc4372		83	rrn26 5' distal flanking region
nc4373		82	orf315-rrn26 intergenic region
nc4378		113	nad5ex5 and its 3' flanking region
nc4380		80	nad5in (trans-spliced)
nc4381		104	nad9 CDS and CDS 3' flanking region
nc4385		67	rpl16 CDS and CDS 3' flanking region
nc4389		160	nad5in (trans-spliced)
nc4394		103	ccmFc CDS
nc4402		60	nad2 CDS
nc4404		110	nad5in (trans-spliced), nad2in (trans-spliced)
nc4405		133	nad5in (trans-spliced), nad2in (trans-spliced)
nc4406		96	rps4 CDS
nc4415		142	nad1 and 3' flanking region
nc4420		54	matR CDS
nc4422		116	orf161 3' flanking region
nc4434		112	orf240a 3' flanking region
nc4436		89	ccmFN1 3' flanking region
nc4439		85	ccmC CDS
nc4444		103	ccmFN2 3' flanking region
nc4450		98	orf153b CDS
nc4456		101	trnS 3' flanking region
nc4457		92	trnS CDS 5' part, atp6 CDS 3' part, atp6-trnS intergenic region
nc4460		111	atp1 3' flanking region
nc4477		71	nad2ex4
nc4482		88	cox1 CDS 3'part and CDS 3' flanking region
nc4491		157	rrn18 3' distal region
Nicotiana tabacum young leaves	plastid	ncRNA	cDNA library, Northern, RNAse protection	Ntc-1	22	very high	psbH-petB intergenic region, 100% conserved in 10 different chloroplast genomes	Lung et al. (2006)
		ncRNA		Ntc-2	22	low	rps7-ndhB ex1 intergenic region, 100% conserved in 960 different chloroplast genomes; homologous sequence found in A. thaliana chloroplast cDNA library
		ncRNA		Ntc-3	45	moderate	rrn4.5-rrn5 intergenic region, 100% conserved in 19 different chloroplast genomes, stable stem–loop structure, sncRNA in the same region identified in A.thaliana
		ncRNA		Ntc-4	55	moderate	trnI-rrn16 intergenic region, 100% conserved in six different chloroplast genomes, stable stem–loop structure
		asRNA		Ntc-5	40	high	atpE 3'UTR, stable stem–loop structure, 100% conserved in five chloroplast genomes
		ncRNA		Ntc-6	19	very low	trnA intron, 100% conserved in 975 different chloroplast genomes, putative part of a miRNA precursor sequence
		asRNA		Ntc-7	18	very low	rps16 intron, 100% conserved in 9 different chloroplast genomes
		ncRNA		Ntc-8	28	very low	psaC-ndhE intergenic region, 100% conserved in 3 different Nicotiana chloroplast genomes
		ncRNA		Ntc-9	23	very low	rps16-trnQ intergenic region, 100% conserved in 19 different chloroplast genomes
		ncRNA		Ntc-10	42	very low	trnR-orf75 intergenic region, 100% conserved in 10 different chloroplast genomes
		ncRNA		Ntc-11	19	very low	trnT-psbD intergenic region, 100% conserved in 3 different chloroplast genomes
		ncRNA		Ntc-12	53	very high	rrn16, 100% conserved in 24 different chloroplast genomes, stable stem–loop structure
Populus tremula x P. alba (INRA clone 7171B4) 4-month-old leaves, Arabidopsis thaliana 'Col' 4-week-old leaves	plastid	asRNA	TAP-5'RACE, Northern	asRNA_ndhB	various species: 400-650	massive accumulation in young leaves; downregulation of asRNA_ndhBat 37OC and its loss at 42OC in Arabidopsisand poplar	ndhBex/in	Georg et al. (2010)
Pinus contorta young needles, Oryza sativa leaf buds	plastid/ nuclear copy of plastid genes?	ncRNA and asRNA	small RNA pyrosequencing	O. sativa 21 small RNAs (#17943, 13332, 15605, 11381, 11649, 11905, 14299, 18179, 11376, 12100, 11553, 17827, 11942, 11975, 12358, 12402, 12784, 13359, 14694, 11428, 11600); P. contorta 7 small RNAs (#188198, 188529, 206471, 183103, 196420, 203011, 236813)	on average 21 at P. contorta and 24 at O. sativa		trnM-3, most from the opposite strand	Morin et al. (2008)
		ncRNA	small RNA pyrosequencing	O. sativa 3 small RNAs (#13445, 189973, 12368); P. contorta 4 small RNAs (#15496, 192443, 211090, 228523)	O. sativa- 19, P. contorta- 15-21		ndhB-rps7
		ncRNA	small RNA pyrosequencing	various small RNAs	on average 21 at P. contorta and 24 at O. sativa		psbB-psbT-psbH-petB-petD polycistronic transcripts (two separate regions)
Brassica rapa ssp. chinensis (heat-sensitive inbred line) 3-week-old seedlings	plastid	sense or as csRNAs (preferentially)	deep sequencing, Northern, RT-PCR (validation of csRNA presence in chloroplasts)	116210 and 78299 unique small RNA sequences in plants grown in modetate temperature and submitted to heat stress, respectively	9-36	most abundant 24 nt ones. After heat treatment, the abundance of csRNAs decreased in seedlings, except those of 24 nt in length. Most affected csRNa derived from rRNA genes; among the tRNA-derived csRNAs, the number of shorter csRNAs (15-25nt) was reduced, while the number of longer csRNAs (29-32nt) was increased. igRNA-derived csRNAs increased by 30% after heat treatment	mRNAs (least abundant; 21-24 nt mostly), rRNAs 3'end preferential (18-25 nt most abundant), tRNAs 5'end (29 nt mainly) and some intergenic regions (22 nt mostly)	Wang et al (2011)
		csRNA	microarrays	csR-4.5sr-1	25		rrn4.5 3’end, with majority in the length ranging from 18 to 25 nt
				csR-4.5sr-1	18		rrn4.5 3’end, with marjority in the length ranging from 18 to 25 nt
				csR-trnD-1	25	decreased after heat stress	trnD 5'end, with abundance peaks at 24, 29 and 31nt
				csR-ig-1	22	the most abundant csRNA from intergenic region, strong increase after heat stress	intergenic region (ig-RNA148)
				csR-trnD-1	24		trnD 5'end,with abundance peaks at 24, 29 and 31nt
				csR-trnP-1	20		trnP 5'end, with abundance peaks at 16 and 24-25nt
				csR-16sr-1	20	decreased after heat stress	rrn16, with the majority in 18-29nt
				csR-16sr-2	23		rrn16 5'end, with abundance peaks at 23 and 28nt
				csR-5sr-3	25		rrn5 5'end, with abundance peaks at 23 and 25nt
				csR-trnA-1	19	increased after heat stress	trnAex3 5'end, with abundance peaks at 19 and 29nt
				csR-trnL-1	25		trnLex4 5'end, with abundance peaks at 22-23 and 29-30nt
				csR-trnA-1	20	reduced after heat stress	trnAex3 5'end, with abundance peaks at 19 and 29nt
				csR-5sr-1	24	decreased after heat treatment	rrn5 3'end, with abundance peak at 24-27nt
				csR-trnL-1	23		trnLex4 5'end, with abundance peaks at 22-23 and 29-30nt
				csR-trnH-1	20		trnH 5'end, with abundance peaks at 20 and 32nt
				csR-16sr-5	21		rrn16, with abundance peak at 22nt
				csR-16sr-3	22		rrn16, with abundance peak at 22nt
				csR-trnE-1	24	increased after heat stress	trnE 5'end, with abundance peak at 24nt
				csR-5sr-2	25	reduced after heat stress	rrn5, with abundance peak at 32nt
				csR-trnL-2	19		trnL 5'end, with abundance peak at 19nt
				csR-trnQ-1	25		trnQ 5'end, with abundance peak at 27nt
				csR-16sr-10	25		rrn16, with majority at 21-26nt
				csR-trnN-1	23	reduced after heat stress	trnN 5' end with its 3' termini at anticodon, with abundance peak at 23nt
				csR-ig-2	23	increased after heat stress	intergenic region (ig-RNA105), with abundance peak at 23nt
				csR-trnG-1	18		trnG 5'end, with abundance peak at 18nt
				csR-mYCF-1	22		ycf77, with abundance peak at 22nt
				csR-trnM-1	18	increased after heat stress	trnM, with a length specificity at 18nt
				csR-23sr-1	21	decreased after heat treatment	rrn23 5'end, with abundance peaks at 21 and 26nt
				csR-trnF-1	19		trnF 5'end, with abundance peaks at 19 and 29nt
				csR-trnG-2	18	reduced after heat stress	trnG ex3 5'end, with abundance peak at 18nt
				csR-trnT-1	25		trnT 5'end, with abundance peak at 25nt
				csR-ig-5	24	reduced after heat stress	intergenic region (ig-RNA114), with abundance peak at 24nt
				csR-ig-6	24	reduced after heat stress	intergenic region (ig-RNA139), with abundance peak at 24nt
				csR-23sr-2	21		rrn23 3'end, with majority at 17 to 21nt
				csR-16sr-6	25		rrn16, with abundance peak at 25nt
				csR-ig-4	26	increased after heat stress	intergenic region (ig-RNA42), with abundance peak at 24nt, increased in HT lines
				csR-ig-3	29		intergenic region (ig-RNA66), with abundance peak at 29nt
				csR-trnV-1	16		trnVex4 5'end, with abundance peaks at 16 and 31nt
				csR-mRPL-1	23		rpl23, with abundance peak at 23nt
				csR-23sr-3	22	reduced after heat stress	rrn23, with abundance peak at 22nt
				csR-16sr-4	22		rrn16 3' end , with abundance peak at 22nt
				csR-trnV-1	25	reduced after heat stress	trnVex4 5'end, with abundance peaks at 16 and 31nt
				csR-trnS-1	25		trnS 5'end, with abundance peak at 25nt
				csR-trnF-1	25		trnF 5'end, with abundance peaks at 19 and 29nt
				csR-trnL-3	22		trnL 5'end, with length specificity of 22nt
				csR-trnN-2	25	reduced after heat stress	trnN 5'end, with abundance peak at 31nt
				csR-trnF-2	16	reduced after heat stress	trnF anticodon, with 16nt length specificity
				csR-mNDH-1	25	increased after heat stress	ndhND2 3'end, with length specificity of 29nt
				csR-trnC-1	25	increased after heat stress	trnC 5'end, with length sepecificity of 25nt
				csR-ig-7	25	increased after heat stress	intergenic region (ig-RNA56), with length specificity of 32nt
				csR-mYCF-2	23	increased after heat stress	ycf1
				csR-mPSB-3	24		psbK, with abundance peak at 23-24nt
				csR-mPSB-4	17	reduced after heat stress	psbA
				csR-ig-8	22	reduced after heat stress	intergenic region (trnA-rrn23)
				csR-mYCF-8	23	decreased after heat stress	with abundance peak at 29-31nt
				csR-mPSB-5	24	increased after heat stress	psbM
				csR-ig-9	25	decreased after heat stress	intergenic region (trnA-rrn23)
				csR-ig-10	23	increased after heat stress	trnIin, with abundance peak at 23nt
				csR-ig-11	23	decreased after heat stress	intergenic region (trnA-rrn23)
				csR-mYCF-3	22	decreased after heat stress	ycf2
				csR-mATP-1	24	increased after heat stress	atpB
				csR-mPSB-6	23	increased after heat stress	psbI
				csR-mRPO-1	23	increased after heat stress	rpoA
csR-mPSB-11	24			decreased after heat stress	psbC
csR-ig-13	22	decreased after heat stress	intergenic region (rrn16-trnI), with 3' end right before trnI ex5
Solanum lycopersicum cv 'MicroTom' developing fruits	plastid/ nuclear copy of plastid genes?	sRNA	deep sequencing	cluster F (10 from 24 member loci)	bias towards 24	up-regulation of sRNA levels at the mature green fruit stage	2 sRNA loci at psaA	Mohorianu et al. (2011)
					bias towards 24		1sRNA locus at atpH
					bias towards 24		4 sRNA loci at ycf2
					bias towards 24		3 sRNA loci at rpoA/B
Salvia miltiorrhiza Bunge cv '99-3' leaves	plastid	asRNA	strand-speciﬁc RNA-Seq, Single-Molecule Real-Time sequencing	nc1	1295	low	psbA	Chen et al. (2014)
		asRNA		nc2	145		matK
		asRNA		nc3	670		trnK
		asRNA		nc4	276		trnK
		asRNA		nc5	1436	high	trnQ
		asRNA		nc6	456		psbK-psbI intergenic region
		asRNA		nc7	263	moderate	trnS
		asRNA		nc8	255		atpA
		asRNA		nc9	211		atpA
		asRNA		nc10	190	low	atpH
		asRNA		nc11	168	low	atpH
		ncRNA		nc12	173		atpH-atpI intergenic region
		asRNA		nc13	194		rpoC2
		asRNA		nc14	208		rpoC2
		asRNA		nc15	206		rpoC2
		asRNA		nc16	194		rpoC2
		asRNA		nc17	214		rpoC2
		asRNA		nc18	218		rpoC1
		asRNA		nc19	414		petN
		ncRNA		nc20	233		petN-psbM intergenic region
		ncRNA		nc21	155		petN-psbM intergenic region
		asRNA		nc22	340		trnD-trnE
		ncRNA		nc23	157	low	trnT-psbD intergenic region
		asRNA		nc24	179	very low	psbD
		asRNA		nc25	161	very low	psbD
		asRNA		nc26	152	very low	psbC
		asRNA		nc27	169	very low	psbC
		asRNA		nc28	218		psbC
		asRNA		nc29	241		trnG
		asRNA		nc30	244		rps14-psaB intergenic region
		asRNA		nc31	166		psaB
		asRNA		nc32	310		psaB
		asRNA		nc33	286	very low	psaB
		ncRNA		nc34	144		psaA-ycf3 intergenic region
		asRNA		nc35	377		ycf3
		asRNA		nc36	273		ycf3
		asRNA		nc37	192	low	ycf3
		ncRNA		nc38	315		ycf3-trnS intergenic region
		ncRNA		nc39	209		ycf3-trnS intergenic region
		ncRNA		nc40	227		ycf3-trnS intergenic region
		asRNA		nc41	245		rps4
		ncRNA		nc42	156		trnT
		asRNA		nc46	243		ndhJ
		asRNA		nc47	393		ndhJ
		asRNA		nc48	158	low	ndhK
		asRNA		nc49	135	low	ndhK-ndhC intergenic region
		ncRNA		nc50	223	moderate	ndhC-trnV intergenic region
		ncRNA		nc51	190		ndhC-trnV intergenic region
		asRNA		nc52	217		atpE
		asRNA		nc53	169		atpE-atpB intergenic region
		asRNA		nc54	413		atpB
		asRNA		nc55	157	low	atpB
		asRNA		nc56	167	low	atpB
		asRNA		nc57	328	low	atpB
		ncRNA		nc58	187		atpB-rbcL intergenic region
		ncRNA		nc59	172		atpB-rbcL intergenic region
		asRNA		nc60	194	very low	rbcL
		asRNA		nc61	204		rbcL
		ncRNA		nc62	365	moderate	rbcL-accD intergenic region
		ncRNA		nc63	183		rbcL-accD intergenic region
		asRNA		nc64	169		accD
		asRNA		nc65	208		accD
		asRNA		nc66	185		accD
		asRNA		nc67	347		petA
ncRNA	nc68	299		petA-psbJ intergenic region
asRNA	nc69	270		psbJ
asRNA	nc70	521	very low	psbL-psbE intergenic region
ncRNA	nc71	156		psbE-petL intergenic region
asRNA	nc72	269		petL
asRNA	nc73	210		rpl33
asRNA	nc74	236		rps18
asRNA	nc75	163		clpP
asRNA	nc76	199		clpP
asRNA	nc77	169	very low	psbB
asRNA	nc78	466	very low	psbB
asRNA	nc79	228	very low	psbB
asRNA	nc80	232	very low	psbB
asRNA	nc81	150		psbH
asRNA	nc82	197		psbB
asRNA	nc83	157	very low	petD
asRNA	nc84	223		rpoA
asRNA	nc85	206		rpoA
asRNA	nc86	178	low	rps11-rpl36 intergenic region
asRNA	nc87	155	low	rps8
asRNA	nc88	160		rpl16
asRNA	nc89	434	moderate	rpl2
asRNA	nc90	512	high	rpl2
asRNA	nc91	335		trnI
asRNA	nc92	1175	very high	ycf15-ndhB intergenic region
asRNA	nc93	230		ndhB
asRNA	nc94	164		ndhB
asRNA	nc95	617	high	ndhB
asRNA	nc96	283		rps7
asRNA	nc97	148		rps12
asRNA	nc98	499		rps12
asRNA	nc99	212		ndhF
asRNA	nc100	283		rpl32
asRNA	nc101	456		trnL
asRNA	nc102	212		ccsA
asRNA	nc103	144	very low	ndhD
asRNA	nc104	171	very low	ndhI
asRNA	nc105	305		ndhA
asRNA	nc106	151		ndhA
asRNA	nc107	165	very low	ndhA
asRNA	nc108	136	low	ndhA
asRNA	nc109	202		ycf1
asRNA	nc110	222	high	ycf1
asRNA	nc111	334	high	ycf1
ncRNA	nc112	211		ycf1-trnN intergenic region
asRNA	nc113	217		trnR
asRNA	nc114	166		rrn5
asRNA	nc115	487	very high	rrn4.5-rrn23 intergenic region
asRNA	nc116	216		rrn23
asRNA	nc117	386		rrn23
asRNA	nc118	286		rrn23-trnA
asRNA	nc119	290	very high	trnA-trnI intergenic region
asRNA	nc120	203		trnI
asRNA	nc121	196		trnI
asRNA	nc122	168		rrn16
asRNA	nc123	208		rrn16
asRNA	nc124	174		rrn16
asRNA	nc125	265		rrn16
asRNA	nc126	183		ycf15
asRNA	nc127	217		ycf2
asRNA	nc128	154		ycf2
asRNA	nc129	195		ycf2
asRNA	nc130	263	high	ycf2
asRNA	nc131	180		ycf2
asRNA	nc132	221		ycf2
asRNA	nc133	174		ycf2
asRNA	nc134	350		ycf2
asRNA	nc135	211		ycf2
asRNA	nc136	172	very high	ycf2
asRNA	nc137	343		ycf2
asRNA	nc138	145		ycf2
asRNA	nc139	159		ycf2
Hordeum vulgare cv 'Haisa' (albostrians mutant line, green and white plastids) 11-day-old leaves	plastid	ncRNA	RNA-seq, 5'RACE, TAP-5'RACE	Hv_nc1			as_psbA*	Zhelyazkova et al. (2012)
				Hv_nc2			as_rps16*
				Hv_nc3			oTSS**
				Hv_nc4			as_psbC; as_psbD*
				Hv_nc5			oTSS**
				Hv_nc6			as_trnG*
				Hv_nc7			as_trnG*
				Hv_nc8			oTSS**
				Hv_nc9			as_trnT*
				Hv_nc10	143-364	moderately abundant primary transcripts in mature chloroplasts	as_trnE*
				Hv_nc11			as_trnE; as_trnY*
				Hv_nc12			oTSS**
				Hv_nc13		very abundant primary transcripts in mature chloroplasts	oTSS**
				Hv_nc14		very abundant primary transcripts in mature chloroplasts	oTSS**
				Hv_nc15			oTSS**
				Hv_nc16			as_rpoC1*
				Hv_nc17			as_rpoC2*
				Hv_nc18	144-394	moderately abundant primary transcripts in mature chloroplasts	as_atpI*
				Hv_nc19			oTSS**
				Hv_nc20			as_atpF*
				Hv_nc21			as_atpA*
				Hv_nc22			as_psaB;as_rps14*
				Hv_nc23			as_psaA(1)*
				Hv_nc24			as_psaA(2)*
				Hv_nc25		very abundant primary transcripts in mature chloroplasts	as_psaA(3)*
				Hv_nc26			as_ycf3(1)*
				Hv_nc27			as_ycf3(2)*
				Hv_nc28		moderately abundant primary transcripts in mature chloroplasts	as_trnF(1)*
				Hv_nc29		moderately abundant primary transcripts in mature chloroplasts	oTSS**
				Hv_nc30			as_trnF(2)*
				Hv_nc31		very abundant primary transcripts in mature chloroplasts	as_trnV*
				Hv_nc32			as_rbcL(1)*
				Hv_nc33			as_rbcL(2)*
				Hv_nc34		very abundant primary transcripts in mature chloroplasts	as_rbcL(3)*
				Hv_nc35			oTSS**
				Hv_nc36			as_psaJ*
				Hv_nc37		moderately abundant primary transcripts in mature chloroplasts	as_psbF; as_psbL*
				Hv_nc38		moderately abundant primary transcripts in mature chloroplasts	as_petG*
				Hv_nc39		very abundant primary transcripts in mature chloroplasts	as_rps18*
				Hv_nc40	48-67	very abundant primary transcripts in mature chloroplasts	as_petB(1)*
				Hv_nc41			as_petB(2)*
				Hv_nc42			as_petB(3)*
				Hv_nc43			as_petB(4)*
				Hv_nc44			as_petD(1)*
				Hv_nc45			as_petD(2)*
				Hv_nc46		very abundant primary transcripts in mature chloroplasts	as_petD(3)*
				Hv_nc47			oTSS**
				Hv_nc48			as_rpl2*
				Hv_nc49			oTSS**
				Hv_nc50	200-210		oTSS**
				Hv_nc51			as_trnL*
				Hv_nc52			as_ndhB*
				Hv_nc53			as_trnA*
				Hv_nc54			as_rrn5*
				Hv_nc55			as_trnR*
				Hv_nc56	128-143		as_rps15*
				Hv_nc57	151-198		as_ndhF(1)*
				Hv_nc58	65-82		as_ndhF(2)*
				Hv_nc59			as_ndhD*
				Hv_nc60			as_ndhD; as_psaC*
Phyllostachy heterocycla cv. pubescens 2-week-old leaves and roots	plastid	sRNA	deep sequencing, Northern		ca. 30	25% and 0.3% of the total reads in leaf and roots libraries, respectively, mapped to the chloroplast genome; ca. 50 most abundant sRNAs mapped to the chloroplast genome in leaf library, but none in root library	ca. 70% of the chloroplast genome matching reads were mapped to rRNA and tRNA genes, 23% of the reads mapped to intergenic regions and 5.6% to protein coding regions (for instance psbZ, ndhJ, atpE, rbcL, rpl33, rpl22, rpl23, rps7)	Xu et al. (2014)

CDS- coding DNA sequence; ex- exon; in- intron; * 'as'- antisense transcripts; mapped candidate genes are given. Consecutive numbers [ex. '(1)', '(2)', etc. or '-1', '-2', etc.] reffers to the distict ncRNA species from the same locus; **oTSS- transcription start site within integenic regions
Data from the most relevant reports were concerned ands sorted according to the experimental material. Reference details- in the text.

Sheet 2: Suppl Tab2a

Supplementary Table 2a. List of the experimentally confirmed Arabidopsis miRNAs with the predicted organellar targets (from PNRD).

No.	Gene ID	miRNA	miRNA sequence	PNRD link	Target AGI	Expectation	Target annotation
1	ath-MIR156i	ath-miR156i	UGACAGAAGAGAGAGAGCAG	ath-miR156i	AT2G17220.2	2.5	Protein kinase superfamily protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase-like domain (InterPro:IPR011009), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT1G76360.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
2	ath-MIR158a	ath-miR158a	UCCCAAAUGUAGACAAAGCA	ath-miR158a	AT3G03580.1	2	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT4G18750.1); Has 54534 Blast hits to 14239 proteins in 270 species: Archae - 2; Bacteria - 13; Metazoa - 57; Fungi - 143; Plants - 53473; Viruses - 0; Other Eukaryotes - 846 (source: NCBI BLink).
3	ath-MIR159b	ath-miR159b	UUUGGAUUGAAGGGAGCUCUU	ath-miR159b	AT4G15530.2	3	pyruvate orthophosphate dikinase (PPDK); FUNCTIONS IN: kinase activity, pyruvate, phosphate dikinase activity; INVOLVED IN: phosphorylation, response to absence of light; LOCATED IN: cytosol, nucleus, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PEP-utilising enzyme, mobile domain (InterPro:IPR008279), ATP-grasp fold, subdomain 1 (InterPro:IPR013815), Pyruvate, phosphate dikinase (InterPro:IPR010121), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate phosphate dikinase, PEP/pyruvate-binding (InterPro:IPR002192), PEP-utilising enzyme, mobile region, conserved site (InterPro:IPR018274), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), PEP-utilising enzyme (InterPro:IPR000121); Has 15301 Blast hits to 15212 proteins in 2599 species: Archae - 294; Bacteria - 9981; Metazoa - 12; Fungi - 19; Plants - 160; Viruses - 0; Other Eukaryotes - 4835 (source: NCBI BLink). The product of this long transcript was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol.
					AT4G15530.4	3	pyruvate orthophosphate dikinase (PPDK); FUNCTIONS IN: kinase activity, pyruvate, phosphate dikinase activity; INVOLVED IN: phosphorylation, response to absence of light; LOCATED IN: cytosol, nucleus, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PEP-utilising enzyme, mobile domain (InterPro:IPR008279), ATP-grasp fold, subdomain 1 (InterPro:IPR013815), Pyruvate, phosphate dikinase (InterPro:IPR010121), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate phosphate dikinase, PEP/pyruvate-binding (InterPro:IPR002192), PEP-utilising enzyme, mobile region, conserved site (InterPro:IPR018274), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), PEP-utilising enzyme (InterPro:IPR000121); Has 15301 Blast hits to 15212 proteins in 2599 species: Archae - 294; Bacteria - 9981; Metazoa - 12; Fungi - 19; Plants - 160; Viruses - 0; Other Eukaryotes - 4835 (source: NCBI BLink). The product of this long transcript was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol.
					AT4G15530.5	3	pyruvate orthophosphate dikinase (PPDK); FUNCTIONS IN: kinase activity, pyruvate, phosphate dikinase activity; INVOLVED IN: phosphorylation, response to absence of light; LOCATED IN: cytosol, nucleus, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PEP-utilising enzyme, mobile domain (InterPro:IPR008279), ATP-grasp fold, subdomain 1 (InterPro:IPR013815), Pyruvate, phosphate dikinase (InterPro:IPR010121), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate phosphate dikinase, PEP/pyruvate-binding (InterPro:IPR002192), PEP-utilising enzyme, mobile region, conserved site (InterPro:IPR018274), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), PEP-utilising enzyme (InterPro:IPR000121); Has 15301 Blast hits to 15212 proteins in 2599 species: Archae - 294; Bacteria - 9981; Metazoa - 12; Fungi - 19; Plants - 160; Viruses - 0; Other Eukaryotes - 4835 (source: NCBI BLink). The product of this long transcript was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol.
4	ath-MIR161	ath-miR161.1	UGAAAGUGACUACAUCGGGGU	ath-miR161.1	AT1G06580.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G64580.1); Has 57463 Blast hits to 14556 proteins in 285 species: Archae - 4; Bacteria - 52; Metazoa - 759; Fungi - 693; Plants - 54152; Viruses - 0; Other Eukaryotes - 1803 (source: NCBI BLink).
					AT1G62670.1	1.5	rna processing factor 2 (RPF2); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G62930.1); Has 71790 Blast hits to 15506 proteins in 316 species: Archae - 6; Bacteria - 84; Metazoa - 1433; Fungi - 1460; Plants - 65974; Viruses - 0; Other Eukaryotes - 2833 (source: NCBI BLink). Required for 5' end processing of nad9 and cox3 mRNAs in mitochondria
					AT1G62910.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G63150.1); Has 124657 Blast hits to 15540 proteins in 305 species: Archae - 10; Bacteria - 122; Metazoa - 2303; Fungi - 2464; Plants - 114740; Viruses - 0; Other Eukaryotes - 5018 (source: NCBI BLink).
					AT1G62930.1	2.5	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G63130.1); Has 70585 Blast hits to 15409 proteins in 318 species: Archae - 8; Bacteria - 85; Metazoa - 1384; Fungi - 1397; Plants - 64906; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink).
					AT1G63080.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G62930.1); Has 67700 Blast hits to 15348 proteins in 310 species: Archae - 4; Bacteria - 76; Metazoa - 1251; Fungi - 1270; Plants - 62359; Viruses - 0; Other Eukaryotes - 2740 (source: NCBI BLink).
					AT1G63130.1	2.5	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62910.1); Has 68218 Blast hits to 15140 proteins in 318 species: Archae - 7; Bacteria - 75; Metazoa - 1255; Fungi - 1382; Plants - 62771; Viruses - 0; Other Eukaryotes - 2728 (source: NCBI BLink).
					AT1G63400.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62590.1); Has 69149 Blast hits to 15301 proteins in 308 species: Archae - 5; Bacteria - 75; Metazoa - 1145; Fungi - 1297; Plants - 63981; Viruses - 0; Other Eukaryotes - 2646 (source: NCBI BLink).
					AT5G16640.1	2	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G41170.1	2.5	Pentatricopeptide repeat (PPR-like) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT3G16710.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
5	ath-MIR161	ath-miR161.2	UCAAUGCAUUGAAAGUGACUA	ath-miR161.2	AT1G06580.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G64580.1); Has 57463 Blast hits to 14556 proteins in 285 species: Archae - 4; Bacteria - 52; Metazoa - 759; Fungi - 693; Plants - 54152; Viruses - 0; Other Eukaryotes - 1803 (source: NCBI BLink).
					AT1G62590.1	1	pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G63330.1); Has 66706 Blast hits to 15368 proteins in 309 species: Archae - 3; Bacteria - 71; Metazoa - 1158; Fungi - 1331; Plants - 61521; Viruses - 0; Other Eukaryotes - 2622 (source: NCBI BLink).
					AT1G62670.1	2.5	rna processing factor 2 (RPF2); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G62930.1); Has 71790 Blast hits to 15506 proteins in 316 species: Archae - 6; Bacteria - 84; Metazoa - 1433; Fungi - 1460; Plants - 65974; Viruses - 0; Other Eukaryotes - 2833 (source: NCBI BLink). Required for 5' end processing of nad9 and cox3 mRNAs in mitochondria
					AT1G62910.1	1.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G63150.1); Has 124657 Blast hits to 15540 proteins in 305 species: Archae - 10; Bacteria - 122; Metazoa - 2303; Fungi - 2464; Plants - 114740; Viruses - 0; Other Eukaryotes - 5018 (source: NCBI BLink).
					AT1G62930.1	1.5	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G63130.1); Has 70585 Blast hits to 15409 proteins in 318 species: Archae - 8; Bacteria - 85; Metazoa - 1384; Fungi - 1397; Plants - 64906; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink).
					AT1G63070.1	2.5	pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62910.1); Has 62253 Blast hits to 15158 proteins in 309 species: Archae - 5; Bacteria - 59; Metazoa - 938; Fungi - 1110; Plants - 57810; Viruses - 0; Other Eukaryotes - 2331 (source: NCBI BLink).
					AT1G63080.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G62930.1); Has 67700 Blast hits to 15348 proteins in 310 species: Archae - 4; Bacteria - 76; Metazoa - 1251; Fungi - 1270; Plants - 62359; Viruses - 0; Other Eukaryotes - 2740 (source: NCBI BLink).
					AT1G63130.1	1.5	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62910.1); Has 68218 Blast hits to 15140 proteins in 318 species: Archae - 7; Bacteria - 75; Metazoa - 1255; Fungi - 1382; Plants - 62771; Viruses - 0; Other Eukaryotes - 2728 (source: NCBI BLink).
6	ath-MIR163	ath-miR163	UUGAAGAGGACUUGGAACUUCGAU	ath-miR163	AT5G35630.1	2.5	glutamine synthetase 2 (GS2); FUNCTIONS IN: glutamate-ammonia ligase activity; INVOLVED IN: in 8 processes; LOCATED IN: in 9 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic domain (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic domain (InterPro:IPR014746); BEST Arabidopsis thaliana protein match is: glutamine synthase clone F11 (TAIR:AT1G66200.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
7	ath-MIR169d	ath-miR169d	UGAGCCAAGGAUGACUUGCCG	ath-miR169d	AT4G35080.1	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
7	ath-MIR169d	ath-miR169d	UGAGCCAAGGAUGACUUGCCG	ath-miR169d	AT4G35080.2	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
8	ath-MIR169e	ath-miR169e	UGAGCCAAGGAUGACUUGCCG	ath-miR169e	AT4G35080.1	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
8	ath-MIR169e	ath-miR169e	UGAGCCAAGGAUGACUUGCCG	ath-miR169e	AT4G35080.2	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
9	ath-MIR169f	ath-miR169f	UGAGCCAAGGAUGACUUGCCG	ath-miR169f	AT4G35080.1	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
9	ath-MIR169f	ath-miR169f	UGAGCCAAGGAUGACUUGCCG	ath-miR169f	AT4G35080.2	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
10	ath-MIR169g	ath-miR169g-5p	UGAGCCAAGGAUGACUUGCCG	ath-miR169g-5p	AT4G35080.1	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
10	ath-MIR169g	ath-miR169g-5p	UGAGCCAAGGAUGACUUGCCG	ath-miR169g-5p	AT4G35080.2	2.5	high-affinity nickel-transport family protein; FUNCTIONS IN: nickel ion transmembrane transporter activity, metal ion binding; INVOLVED IN: nickel ion transport, transmembrane transport, metal ion transport; LOCATED IN: integral to membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Nickel/cobalt transporter, high-affinity (InterPro:IPR011541); BEST Arabidopsis thaliana protein match is: high-affinity nickel-transport family protein (TAIR:AT2G16800.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
11	ath-MIR170	ath-miR170	UGAUUGAGCCGUGUCAAUAUC	ath-miR170	AT3G55410.1	3	2-oxoglutarate dehydrogenase, E1 component; FUNCTIONS IN: oxoglutarate dehydrogenase (succinyl-transferring) activity, cobalt ion binding, zinc ion binding; INVOLVED IN: glycolysis, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase-like, pyrimidine-binding domain (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase, E1 component (TAIR:AT5G65750.1); Has 10999 Blast hits to 10962 proteins in 1954 species: Archae - 31; Bacteria - 4409; Metazoa - 546; Fungi - 299; Plants - 167; Viruses - 0; Other Eukaryotes - 5547 (source: NCBI BLink).
12	ath-MIR171b	ath-miR171b	UUGAGCCGUGCCAAUAUCACG	ath-miR171b	AT5G23250.1	2.5	Succinyl-CoA ligase, alpha subunit; FUNCTIONS IN: succinate-CoA ligase (GDP-forming) activity, copper ion binding; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding domain (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: Succinyl-CoA ligase, alpha subunit (TAIR:AT5G08300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
13	ath-MIR171c	ath-miR171c	UUGAGCCGUGCCAAUAUCACG	ath-miR171c	AT5G23250.1	2.5	Succinyl-CoA ligase, alpha subunit; FUNCTIONS IN: succinate-CoA ligase (GDP-forming) activity, copper ion binding; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding domain (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: Succinyl-CoA ligase, alpha subunit (TAIR:AT5G08300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
14	ath-MIR172b	ath-miR172b-5p	GCAGCACCAUUAAGAUUCAC	ath-miR172b-5p	AT2G16500.1	2	arginine decarboxylase 1 (ADC1); CONTAINS InterPro DOMAIN/s: Orn/DAP/Arg decarboxylase 2, C-terminal (InterPro:IPR022643), Orn/DAP/Arg decarboxylase 2, conserved site (InterPro:IPR022657), Orn/DAP/Arg decarboxylase 2, pyridoxal-phosphate binding site (InterPro:IPR022653), Ornithine/DAP/Arg decarboxylase (InterPro:IPR000183), Arginine decarboxylase (InterPro:IPR002985), Orn/DAP/Arg decarboxylase 2, N-terminal (InterPro:IPR022644); BEST Arabidopsis thaliana protein match is: arginine decarboxylase 2 (TAIR:AT4G34710.2); Has 7460 Blast hits to 7389 proteins in 2069 species: Archae - 108; Bacteria - 5016; Metazoa - 91; Fungi - 35; Plants - 637; Viruses - 2; Other Eukaryotes - 1571 (source: NCBI BLink).
14	ath-MIR172b	ath-miR172b-5p	GCAGCACCAUUAAGAUUCAC	ath-miR172b-5p	AT5G48830.1	3	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
15	ath-MIR173	ath-miR173	UUCGCUUGCAGAGAGAAAUCAC	ath-miR172m	AT5G20200.1	3	nucleoporin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10650.1); Has 1474 Blast hits to 595 proteins in 170 species: Archae - 0; Bacteria - 165; Metazoa - 255; Fungi - 183; Plants - 74; Viruses - 0; Other Eukaryotes - 797 (source: NCBI BLink).
16	ath-MIR1886	ath-miR1886.1	UGAGAGAAGUGAGAUGAAAUC	ath-miR1886.1	AT1G10700.1	2	phosphoribosyl pyrophosphate (PRPP) synthase 3 (PRS3); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: nucleotide biosynthetic process, nucleoside metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946); BEST Arabidopsis thaliana protein match is: Phosphoribosyltransferase family protein (TAIR:AT2G42910.1); Has 9536 Blast hits to 9535 proteins in 2732 species: Archae - 207; Bacteria - 5887; Metazoa - 527; Fungi - 344; Plants - 201; Viruses - 8; Other Eukaryotes - 2362 (source: NCBI BLink).
16	ath-MIR1886	ath-miR1886.1	UGAGAGAAGUGAGAUGAAAUC	ath-miR1886.1	AT2G47940.1	3	DEGP protease 2 (DEGP2); FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: photosystem II repair, proteolysis; LOCATED IN: chloroplast stromal thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Serine/cysteine peptidase, trypsin-like (InterPro:IPR009003), Serine endopeptidase DegP2 (InterPro:IPR015724), Peptidase S1C, HrtA/DegP2/Q/S (InterPro:IPR001940), Peptidase S1/S6, chymotrypsin/Hap (InterPro:IPR001254), PDZ/DHR/GLGF (InterPro:IPR001478); BEST Arabidopsis thaliana protein match is: DegP protease 9 (TAIR:AT5G40200.1); Has 15046 Blast hits to 15035 proteins in 2533 species: Archae - 101; Bacteria - 10614; Metazoa - 317; Fungi - 14; Plants - 376; Viruses - 0; Other Eukaryotes - 3624 (source: NCBI BLink).
17	ath-MIR2111a	ath-miR2111a-5p	UAAUCUGCAUCCUGAGGUUUA	ath-miR2111a-5p	AT5G52010.1	2.5	C2H2-like zinc finger protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G12240.1); Has 70 Blast hits to 70 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 65; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
18	ath-MIR2111a	ath-miR2111a-3p	GUCCUCGGGAUGCGGAUUACC	ath-miR2111a-3p	AT5G10460.1	3	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIA, hypothetical 3 (InterPro:IPR006356); Has 4117 Blast hits to 4117 proteins in 1113 species: Archae - 73; Bacteria - 2243; Metazoa - 198; Fungi - 54; Plants - 37; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink).
19	ath-MIR2111b	ath-miR2111b-5p	UAAUCUGCAUCCUGAGGUUUA	ath-miR2111b-5p	AT5G52010.1	2.5	C2H2-like zinc finger protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G12240.1); Has 70 Blast hits to 70 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 65; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
20	ath-MIR2112	ath-miR2112-5p	CGCAAAUGCGGAUAUCAAUGU	ath-miR2112-5p	AT5G02860.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G18940.1); Has 78068 Blast hits to 16233 proteins in 339 species: Archae - 4; Bacteria - 143; Metazoa - 1692; Fungi - 1544; Plants - 71427; Viruses - 0; Other Eukaryotes - 3258 (source: NCBI BLink).
21	ath-MIR2933a	ath-miR2933a	GAAAUCGGAGAGGAAAUUCGCC	ath-miR2933a	AT1G58235.1	2.5	unknown protein; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
21	ath-MIR2933a	ath-miR2933a	GAAAUCGGAGAGGAAAUUCGCC	ath-miR2933a	AT5G27440.1	1.5	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot apex, shoot, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
22	ath-MIR2933b	ath-miR2933b	GAAAUCGGAGAGGAAAUUCGCC	ath-miR2933b	AT1G58235.1	2.5	unknown protein; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
22	ath-MIR2933b	ath-miR2933b	GAAAUCGGAGAGGAAAUUCGCC	ath-miR2933b	AT5G27440.1	1.5	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot apex, shoot, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
23	ath-MIR2935	ath-miR2935	UGGAAUCACACGGUCGUCAUUC	ath-miR2935	AT1G61980.1	2.5	Mitochondrial transcription termination factor family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cold; LOCATED IN: mitochondrion, nucleus; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: Mitochondrial transcription termination factor family protein (TAIR:AT1G61970.2); Has 813 Blast hits to 762 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 8; Plants - 792; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
24	ath-MIR2937	ath-miR2937	AUAAGAGCUGUUGAAGGAGUC	ath-miR2937	AT3G02450.1	2.5	cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH protease 8 (TAIR:AT1G06430.1); Has 43920 Blast hits to 41347 proteins in 3350 species: Archae - 1585; Bacteria - 19560; Metazoa - 4991; Fungi - 3838; Plants - 3354; Viruses - 31; Other Eukaryotes - 10561 (source: NCBI BLink).
25	ath-MIR2938	ath-miR2938	GAUCUUUUGAGAGGGUUCCAG	ath-miR2938	AT1G73820.1	2.5	Ssu72-like family protein; FUNCTIONS IN: phosphoprotein phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II subunit A (InterPro:IPR006811); Has 454 Blast hits to 453 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 228; Fungi - 149; Plants - 48; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
					AT4G08870.1	2.5	Arginase/deacetylase superfamily protein; FUNCTIONS IN: arginase activity, cobalt ion binding, agmatinase activity; INVOLVED IN: response to jasmonic acid stimulus, polyamine metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: sepal vascular system, cotyledon vascular system, root vascular system, style, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Ureohydrolase (InterPro:IPR006035); BEST Arabidopsis thaliana protein match is: arginase (TAIR:AT4G08900.1); Has 8845 Blast hits to 8843 proteins in 1673 species: Archae - 297; Bacteria - 4692; Metazoa - 410; Fungi - 370; Plants - 72; Viruses - 0; Other Eukaryotes - 3004 (source: NCBI BLink).
					AT4G08870.2	2.5	Arginase/deacetylase superfamily protein; FUNCTIONS IN: arginase activity, cobalt ion binding, agmatinase activity; INVOLVED IN: response to jasmonic acid stimulus, polyamine metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: sepal vascular system, cotyledon vascular system, root vascular system, style, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Ureohydrolase (InterPro:IPR006035); BEST Arabidopsis thaliana protein match is: arginase (TAIR:AT4G08900.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
					AT4G08900.1	3	arginase; FUNCTIONS IN: arginase activity, cobalt ion binding, agmatinase activity; INVOLVED IN: defense response to bacterium, arginine catabolic process, polyamine metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; CONTAINS InterPro DOMAIN/s: Ureohydrolase (InterPro:IPR006035), Ureohydrolase, manganese-binding site (InterPro:IPR020855); BEST Arabidopsis thaliana protein match is: Arginase/deacetylase superfamily protein (TAIR:AT4G08870.1); Has 9226 Blast hits to 9224 proteins in 1712 species: Archae - 292; Bacteria - 4928; Metazoa - 419; Fungi - 376; Plants - 74; Viruses - 0; Other Eukaryotes - 3137 (source: NCBI BLink).
					AT5G01110.1	2.5	Tetratricopeptide repeat (TPR)-like superfamily protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR-like) superfamily protein (TAIR:AT1G05670.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G52810.1	2.5	NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: structural constituent of eye lens, binding, catalytic activity; INVOLVED IN: arginine catabolic process to glutamate, nopaline catabolic process, metabolic process, octopine catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding domain (InterPro:IPR016040), Ornithine cyclodeaminase/mu-crystallin (InterPro:IPR003462); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
26	ath-MIR3434	ath-miR3434-5p	ACUUGGCUGAUUCUAUUAUU	ath-miR3434-5p	AT2G19870.1	3	tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: methyltransferase activity, RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537), RNA methyltransferase TrmH, group 3 (InterPro:IPR004441), RNA 2-O ribose methyltransferase, substrate binding (InterPro:IPR013123); Has 11661 Blast hits to 11576 proteins in 2636 species: Archae - 7; Bacteria - 7686; Metazoa - 749; Fungi - 216; Plants - 206; Viruses - 3; Other Eukaryotes - 2794 (source: NCBI BLink).
27	ath-MIR3434	ath-miR3434-3p	UCAGAGUAUCAGCCAUGUGA	ath-miR3434-3p	AT1G71060.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G77360.1); Has 34236 Blast hits to 11484 proteins in 290 species: Archae - 3; Bacteria - 45; Metazoa - 348; Fungi - 482; Plants - 32361; Viruses - 0; Other Eukaryotes - 997 (source: NCBI BLink).
27	ath-MIR3434	ath-miR3434-3p	UCAGAGUAUCAGCCAUGUGA	ath-miR3434-3p	AT3G26840.1	3	Esterase/lipase/thioesterase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, catalytic activity, acyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: plastoglobule; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130), Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: Esterase/lipase/thioesterase family protein (TAIR:AT3G26820.1); Has 601 Blast hits to 592 proteins in 177 species: Archae - 0; Bacteria - 312; Metazoa - 80; Fungi - 0; Plants - 156; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
28	ath-MIR3440b	ath-miR3440b-5p	UUUUCUUGGCCCAUCCACUUC	ath-miR3440b-5p	AT5G08490.1	2.5	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21300.1); Has 47451 Blast hits to 12929 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 30; Plants - 46987; Viruses - 0; Other Eukaryotes - 385 (source: NCBI BLink).
29	ath-MIR395a	ath-miR395a	CUGAAGUGUUUGGGGGAACUC	ath-miR395a	AT2G28780.1	1.5	unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
					AT3G22890.1	3	ATP sulfurylase 1 (APS1); FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: chloroplast, plasma membrane, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 2073 Blast hits to 2070 proteins in 648 species: Archae - 98; Bacteria - 862; Metazoa - 241; Fungi - 201; Plants - 187; Viruses - 0; Other Eukaryotes - 484 (source: NCBI BLink).
					AT4G14680.1	3	APS3; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: ATP sulfurylase 1 (TAIR:AT3G22890.1); Has 2059 Blast hits to 2056 proteins in 649 species: Archae - 98; Bacteria - 865; Metazoa - 242; Fungi - 201; Plants - 189; Viruses - 0; Other Eukaryotes - 464 (source: NCBI BLink).
					AT5G13630.1	2	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G13630.2	2	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 3665 Blast hits to 3123 proteins in 644 species: Archae - 281; Bacteria - 1903; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 1389 (source: NCBI BLink).
					AT5G43780.1	1.5	APS4; FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: sulfate assimilation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
30	ath-MIR395b	ath-miR395b	CUGAAGUGUUUGGGGGGACUC	ath-miR395b	AT2G28780.1	1.5	unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
					AT5G13630.1	2.5	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G13630.2	2.5	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G43780.1	2	APS4; FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: sulfate assimilation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
31	ath-MIR395c	ath-miR395c	CUGAAGUGUUUGGGGGGACUC	ath-miR395c	AT2G28780.1	1.5	unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
					AT5G13630.1	2.5	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G13630.2	2.5	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G43780.1	2	APS4; FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: sulfate assimilation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
32	ath-MIR395d	ath-miR395d	CUGAAGUGUUUGGGGGAACUC	ath-miR395d	AT2G28780.1	1.5	unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
					AT3G22890.1	3	ATP sulfurylase 1 (APS1); FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: chloroplast, plasma membrane, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 2073 Blast hits to 2070 proteins in 648 species: Archae - 98; Bacteria - 862; Metazoa - 241; Fungi - 201; Plants - 187; Viruses - 0; Other Eukaryotes - 484 (source: NCBI BLink).
					AT4G14680.1	3	APS3; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: ATP sulfurylase 1 (TAIR:AT3G22890.1); Has 2059 Blast hits to 2056 proteins in 649 species: Archae - 98; Bacteria - 865; Metazoa - 242; Fungi - 201; Plants - 189; Viruses - 0; Other Eukaryotes - 464 (source: NCBI BLink).
					AT5G13630.1	2	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G13630.2	2	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G43780.1	1.5	APS4; FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: sulfate assimilation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
33	ath-MIR395e	ath-miR395e	CUGAAGUGUUUGGGGGAACUC	ath-miR395e	AT2G28780.1	1.5	unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
					AT3G22890.1	3	ATP sulfurylase 1 (APS1); FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: chloroplast, plasma membrane, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 2073 Blast hits to 2070 proteins in 648 species: Archae - 98; Bacteria - 862; Metazoa - 241; Fungi - 201; Plants - 187; Viruses - 0; Other Eukaryotes - 484 (source: NCBI BLink).
					AT4G14680.1	3	APS3; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: ATP sulfurylase 1 (TAIR:AT3G22890.1); Has 2059 Blast hits to 2056 proteins in 649 species: Archae - 98; Bacteria - 865; Metazoa - 242; Fungi - 201; Plants - 189; Viruses - 0; Other Eukaryotes - 464 (source: NCBI BLink).
					AT5G13630.1	2	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G13630.2	2	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G43780.1	1.5	APS4; FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: sulfate assimilation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
34	ath-MIR395f	ath-miR395f	CUGAAGUGUUUGGGGGGACUC	th-miR395f	AT2G28780.1	1.5	unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 305 species: Archae - 0; Bacteria - 588; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
					AT5G13630.1	2.5	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G13630.2	2.5	GENOMES UNCOUPLED 5 (GUN5); FUNCTIONS IN: magnesium chelatase activity; INVOLVED IN: chlorophyll biosynthetic process, biosynthetic process; LOCATED IN: mitochondrion, magnesium chelatase complex, chloroplast, chloroplast inner membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CobN/magnesium chelatase (InterPro:IPR003672), Magnesium-chelatase, subunit H (InterPro:IPR011771); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G43780.1	2	APS4; FUNCTIONS IN: sulfate adenylyltransferase (ATP) activity; INVOLVED IN: sulfate assimilation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Pseudouridine synthase/archaeosine transglycosylase-like (InterPro:IPR015947), Sulphate adenylyltransferase (InterPro:IPR002650); BEST Arabidopsis thaliana protein match is: Pseudouridine synthase/archaeosine transglycosylase-like family protein (TAIR:AT4G14680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
35	ath-MIR396a	ath-miR396a	UUCCACAGCUUUCUUGAACUG	ath-miR396a	AT2G15630.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G01110.1); Has 56384 Blast hits to 14280 proteins in 305 species: Archae - 4; Bacteria - 41; Metazoa - 1079; Fungi - 1056; Plants - 52130; Viruses - 0; Other Eukaryotes - 2074 (source: NCBI BLink).
					AT3G14110.1	2.5	FLUORESCENT IN BLUE LIGHT (FLU); FUNCTIONS IN: binding; INVOLVED IN: chlorophyll biosynthetic process, oxylipin biosynthetic process, response to singlet oxygen; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026); Has 863 Blast hits to 502 proteins in 124 species: Archae - 8; Bacteria - 276; Metazoa - 453; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).
					AT3G14110.2	2.5	FLUORESCENT IN BLUE LIGHT (FLU); FUNCTIONS IN: binding; INVOLVED IN: chlorophyll biosynthetic process, oxylipin biosynthetic process, response to singlet oxygen; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
					AT5G57590.1	2.5	biotin auxotroph 1 (BIO1); CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: HOPW1-1-interacting 1 (TAIR:AT1G80600.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
36	ath-MIR396b	ath-miR396b	UUCCACAGCUUUCUUGAACUU	ath-miR396b	AT2G15630.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G01110.1); Has 56384 Blast hits to 14280 proteins in 305 species: Archae - 4; Bacteria - 41; Metazoa - 1079; Fungi - 1056; Plants - 52130; Viruses - 0; Other Eukaryotes - 2074 (source: NCBI BLink).
					AT3G14110.1	3	FLUORESCENT IN BLUE LIGHT (FLU); FUNCTIONS IN: binding; INVOLVED IN: chlorophyll biosynthetic process, oxylipin biosynthetic process, response to singlet oxygen; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026); Has 863 Blast hits to 502 proteins in 124 species: Archae - 8; Bacteria - 276; Metazoa - 453; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).
					AT3G14110.2	3	FLUORESCENT IN BLUE LIGHT (FLU); FUNCTIONS IN: binding; INVOLVED IN: chlorophyll biosynthetic process, oxylipin biosynthetic process, response to singlet oxygen; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026); Has 863 Blast hits to 502 proteins in 124 species: Archae - 8; Bacteria - 276; Metazoa - 453; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).
					AT5G57590.1	2.5	biotin auxotroph 1 (BIO1); CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: HOPW1-1-interacting 1 (TAIR:AT1G80600.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
37	ath-MIR397a	ath-miR397a	UCAUUGAGUGCAGCGUUGAUG	ath-miR397a	AT1G66670.1	2.5	CLP protease proteolytic subunit 3 (CLPP3); FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP, active site (InterPro:IPR018215), Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLP protease P4 (TAIR:AT5G45390.1); Has 13369 Blast hits to 13367 proteins in 2989 species: Archae - 6; Bacteria - 8381; Metazoa - 147; Fungi - 79; Plants - 1070; Viruses - 92; Other Eukaryotes - 3594 (source: NCBI BLink).
38	ath-MIR398a	ath-miR398a	UGUGUUCUCAGGUCACCCCUU	ath-miR398a	AT1G36078.1	3	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
39	ath-MIR399a	ath-miR399a	UGCCAAAGGAGAUUUGCCCUG	ath-miR399a	AT2G26900.1	3	Sodium Bile acid symporter family; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport, organic anion transport; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657), Bile acid transporter (InterPro:IPR004710); BEST Arabidopsis thaliana protein match is: Sodium Bile acid symporter family (TAIR:AT1G78560.1); Has 5023 Blast hits to 5015 proteins in 1109 species: Archae - 92; Bacteria - 2706; Metazoa - 448; Fungi - 4; Plants - 268; Viruses - 0; Other Eukaryotes - 1505 (source: NCBI BLink).
40	ath-MIR399d	ath-miR399d	UGCCAAAGGAGAUUUGCCCCG	ath-miR399d	AT2G26900.1	3	Sodium Bile acid symporter family; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport, organic anion transport; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657), Bile acid transporter (InterPro:IPR004710); BEST Arabidopsis thaliana protein match is: Sodium Bile acid symporter family (TAIR:AT1G78560.1); Has 5023 Blast hits to 5015 proteins in 1109 species: Archae - 92; Bacteria - 2706; Metazoa - 448; Fungi - 4; Plants - 268; Viruses - 0; Other Eukaryotes - 1505 (source: NCBI BLink).
41	ath-MIR399f	ath-miR399f	UGCCAAAGGAGAUUUGCCCGG	ath-miR399f	AT2G26900.1	2.5	Sodium Bile acid symporter family; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport, organic anion transport; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657), Bile acid transporter (InterPro:IPR004710); BEST Arabidopsis thaliana protein match is: Sodium Bile acid symporter family (TAIR:AT1G78560.1); Has 5023 Blast hits to 5015 proteins in 1109 species: Archae - 92; Bacteria - 2706; Metazoa - 448; Fungi - 4; Plants - 268; Viruses - 0; Other Eukaryotes - 1505 (source: NCBI BLink).
42	ath-MIR400	ath-miR400	UAUGAGAGUAUUAUAAGUCAC	ath-miR400	AT1G06580.1	0	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G64580.1); Has 57463 Blast hits to 14556 proteins in 285 species: Archae - 4; Bacteria - 52; Metazoa - 759; Fungi - 693; Plants - 54152; Viruses - 0; Other Eukaryotes - 1803 (source: NCBI BLink).
					AT1G22960.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G01110.1); Has 58924 Blast hits to 14815 proteins in 307 species: Archae - 4; Bacteria - 65; Metazoa - 926; Fungi - 1075; Plants - 54939; Viruses - 0; Other Eukaryotes - 1915 (source: NCBI BLink).
					AT1G62590.1	2	pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G63330.1); Has 66706 Blast hits to 15368 proteins in 309 species: Archae - 3; Bacteria - 71; Metazoa - 1158; Fungi - 1331; Plants - 61521; Viruses - 0; Other Eukaryotes - 2622 (source: NCBI BLink).
					AT1G62670.1	2	rna processing factor 2 (RPF2); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G62930.1); Has 71790 Blast hits to 15506 proteins in 316 species: Archae - 6; Bacteria - 84; Metazoa - 1433; Fungi - 1460; Plants - 65974; Viruses - 0; Other Eukaryotes - 2833 (source: NCBI BLink).
					AT1G62720.1	1	Pentatricopeptide repeat (PPR-like) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62680.1); Has 62070 Blast hits to 15065 proteins in 304 species: Archae - 4; Bacteria - 67; Metazoa - 643; Fungi - 921; Plants - 58400; Viruses - 0; Other Eukaryotes - 2035 (source: NCBI BLink).
					AT1G62930.1	1.5	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G63130.1); Has 70585 Blast hits to 15409 proteins in 318 species: Archae - 8; Bacteria - 85; Metazoa - 1384; Fungi - 1397; Plants - 64906; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink).
					AT1G63070.1	2.5	pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62910.1); Has 62253 Blast hits to 15158 proteins in 309 species: Archae - 5; Bacteria - 59; Metazoa - 938; Fungi - 1110; Plants - 57810; Viruses - 0; Other Eukaryotes - 2331 (source: NCBI BLink).
					AT1G63080.1	3	Pentatricopeptide repeat (PPR) superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G62930.1); Has 67700 Blast hits to 15348 proteins in 310 species: Archae - 4; Bacteria - 76; Metazoa - 1251; Fungi - 1270; Plants - 62359; Viruses - 0; Other Eukaryotes - 2740 (source: NCBI BLink).
					AT1G63130.1	1.5	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62910.1); Has 68218 Blast hits to 15140 proteins in 318 species: Archae - 7; Bacteria - 75; Metazoa - 1255; Fungi - 1382; Plants - 62771; Viruses - 0; Other Eukaryotes - 2728 (source: NCBI BLink).
					AT1G63400.1	2.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62590.1); Has 69149 Blast hits to 15301 proteins in 308 species: Archae - 5; Bacteria - 75; Metazoa - 1145; Fungi - 1297; Plants - 63981; Viruses - 0; Other Eukaryotes - 2646 (source: NCBI BLink).
					AT1G64580.1	2	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G06580.1); Has 112573 Blast hits to 15264 proteins in 312 species: Archae - 7; Bacteria - 103; Metazoa - 1711; Fungi - 1794; Plants - 105295; Viruses - 0; Other Eukaryotes - 3663 (source: NCBI BLink).
					AT1G77405.1	1.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G39710.1); Has 29650 Blast hits to 9898 proteins in 260 species: Archae - 4; Bacteria - 20; Metazoa - 223; Fungi - 306; Plants - 28152; Viruses - 0; Other Eukaryotes - 945 (source: NCBI BLink).
					AT3G16710.1	1.5	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR-like) superfamily protein (TAIR:AT5G41170.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
					AT3G22470.1	1	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G12300.1); Has 71386 Blast hits to 15586 proteins in 313 species: Archae - 4; Bacteria - 76; Metazoa - 1075; Fungi - 1368; Plants - 66381; Viruses - 0; Other Eukaryotes - 2482 (source: NCBI BLink).
					AT4G19440.1	2	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G55840.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
					AT5G16640.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62680.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
					AT5G39710.1	2.5	EMBRYO DEFECTIVE 2745 (EMB2745); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G55840.1); Has 65335 Blast hits to 15466 proteins in 320 species: Archae - 6; Bacteria - 88; Metazoa - 1398; Fungi - 1479; Plants - 59659; Viruses - 0; Other Eukaryotes - 2705 (source: NCBI BLink).
					AT5G41170.1	2.5	Pentatricopeptide repeat (PPR-like) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT3G16710.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
43	ath-MIR402	ath-miR402	UUCGAGGCCUAUUAAACCUCUG	ath-miR402	AT1G70070.1	3	EMBRYO DEFECTIVE 25 (EMB25); FUNCTIONS IN: RNA helicase activity, ATP-dependent helicase activity; INVOLVED IN: posttranscriptional gene silencing, plasmodesmata-mediated intercellular transport, embryo development ending in seed dormancy; LOCATED IN: stress granule, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DSH, C-terminal (InterPro:IPR012961), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, ATP-dependent, SK12/DOB1 protein (TAIR:AT3G46960.1); Has 21396 Blast hits to 12786 proteins in 1473 species: Archae - 1027; Bacteria - 4600; Metazoa - 5457; Fungi - 2724; Plants - 1158; Viruses - 307; Other Eukaryotes - 6123 (source: NCBI BLink).
44	ath-MIR404	ath-miR404	AUUAACGCUGGCGGUUGCGGCAGC	ath-miR404	AT4G34120.1	3	LOSS OF THE TIMING OF ET AND JA BIOSYNTHESIS 1 (LEJ1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: Cystathionine beta-synthase (CBS) family protein (TAIR:AT4G36910.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
45	ath-MIR406	ath-miR406	UAGAAUGCUAUUGUAAUCCAG	ath-miR406	AT3G54980.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: LATERAL ORGAN JUNCTION (TAIR:AT2G39230.1); Has 66577 Blast hits to 14412 proteins in 313 species: Archae - 5; Bacteria - 80; Metazoa - 1084; Fungi - 1336; Plants - 61678; Viruses - 0; Other Eukaryotes - 2394 (source: NCBI BLink).
46	ath-MIR407	ath-miR407	UUUAAAUCAUAUACUUUUGGU	ath-miR407	AT1G68460.1	2	isopentenyltransferase 1 (IPT1); FUNCTIONS IN: AMP dimethylallyltransferase activity, ATP/ADP dimethylallyltransferase activity; INVOLVED IN: cytokinin biosynthetic process, secondary growth; LOCATED IN: chloroplast; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: tRNA isopentenyltransferase (InterPro:IPR002627); BEST Arabidopsis thaliana protein match is: ATP/ADP isopentenyltransferases (TAIR:AT3G19160.1); Has 7944 Blast hits to 7761 proteins in 2606 species: Archae - 0; Bacteria - 5388; Metazoa - 167; Fungi - 152; Plants - 293; Viruses - 0; Other Eukaryotes - 1944 (source: NCBI BLink).
47	ath-MIR413	ath-miR413	AUAGUUUCUCUUGUUCUGCAC	ath-miR413	AT3G16890.1	3	pentatricopeptide (PPR) domain protein 40 (PPR40); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G39710.1); Has 55842 Blast hits to 14078 proteins in 304 species: Archae - 4; Bacteria - 51; Metazoa - 561; Fungi - 1019; Plants - 52283; Viruses - 0; Other Eukaryotes - 1924 (source: NCBI BLink).
					AT4G35130.1	2.5	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT4G18750.1); Has 46569 Blast hits to 13927 proteins in 247 species: Archae - 0; Bacteria - 4; Metazoa - 46; Fungi - 110; Plants - 45942; Viruses - 0; Other Eukaryotes - 467 (source: NCBI BLink).
					AT5G44780.1	2.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G20020.2); Has 9661 Blast hits to 6233 proteins in 635 species: Archae - 4; Bacteria - 1116; Metazoa - 4251; Fungi - 1510; Plants - 1359; Viruses - 43; Other Eukaryotes - 1378 (source: NCBI BLink).
48	ath-MIR414	ath-miR414	UCAUCUUCAUCAUCAUCGUCA	ath-miR414	AT2G33250.1	0	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04310.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
49	ath-MIR415	ath-miR415	AACAGAGCAGAAACAGAACAU	ath-miR415	AT1G32080.1	2.5	membrane protein, putative; LOCATED IN: chloroplast, chloroplast inner membrane, membrane, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LrgB-like protein (InterPro:IPR007300); Has 3603 Blast hits to 3592 proteins in 1271 species: Archae - 22; Bacteria - 3356; Metazoa - 0; Fungi - 58; Plants - 57; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).
50	ath-MIR419	ath-miR419	UUAUGAAUGCUGAGGAUGUUG	ath-miR419	AT4G30000.1	3	Dihydropterin pyrophosphokinase / Dihydropteroate synthase; FUNCTIONS IN: 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase activity, dihydropteroate synthase activity; INVOLVED IN: pteridine and derivative metabolic process, cellular metabolic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dihydropteroate synthase-like (InterPro:IPR011005), 7,8-Dihydro-6-hydroxymethylpterin-pyrophosphokinase, HPPK (InterPro:IPR000550), Dihydropteroate synthase (InterPro:IPR006390), Pterin-binding (InterPro:IPR000489); BEST Arabidopsis thaliana protein match is: Dihydropterin pyrophosphokinase / Dihydropteroate synthase (TAIR:AT1G69190.1); Has 14894 Blast hits to 14858 proteins in 2526 species: Archae - 148; Bacteria - 9690; Metazoa - 8; Fungi - 166; Plants - 69; Viruses - 0; Other Eukaryotes - 4813 (source: NCBI BLink).
51	ath-MIR4221	ath-miR4221	UUUUCCUCUGUUGAAUUCUUGC	ath-miR4221	AT1G69740.1	2.5	putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.; HEMB1; FUNCTIONS IN: porphobilinogen synthase activity, catalytic activity, metal ion binding; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Tetrapyrrole biosynthesis, porphobilinogen synthase (InterPro:IPR001731); BEST Arabidopsis thaliana protein match is: Aldolase superfamily protein (TAIR:AT1G44318.1); Has 6820 Blast hits to 6820 proteins in 2111 species: Archae - 162; Bacteria - 3714; Metazoa - 160; Fungi - 160; Plants - 86; Viruses - 0; Other Eukaryotes - 2538 (source: NCBI BLink).
					AT1G69740.2	2.5	putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis; HEMB1; FUNCTIONS IN: porphobilinogen synthase activity, catalytic activity, metal ion binding; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Tetrapyrrole biosynthesis, porphobilinogen synthase (InterPro:IPR001731); BEST Arabidopsis thaliana protein match is: Aldolase superfamily protein (TAIR:AT1G44318.1); Has 6820 Blast hits to 6820 proteins in 2111 species: Archae - 162; Bacteria - 3714; Metazoa - 160; Fungi - 160; Plants - 86; Viruses - 0; Other Eukaryotes - 2538 (source: NCBI BLink).
					AT1G77660.1	3	Histone H3 K4-specific methyltransferase SET7/9 family protein; CONTAINS InterPro DOMAIN/s: MORN motif (InterPro:IPR003409); BEST Arabidopsis thaliana protein match is: Histone H3 K4-specific methyltransferase SET7/9 family protein (TAIR:AT1G21920.1); Has 25589 Blast hits to 6526 proteins in 562 species: Archae - 0; Bacteria - 3550; Metazoa - 4135; Fungi - 204; Plants - 2355; Viruses - 0; Other Eukaryotes - 15345 (source: NCBI BLink).
					AT4G13070.1	2.5	RNA-binding CRS1 / YhbY (CRM) domain protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA-binding CRS1 / YhbY (CRM) domain protein (TAIR:AT2G28480.1); Has 317 Blast hits to 276 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 5; Fungi - 0; Plants - 270; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
52	ath-MIR4227	ath-miR4227	UCACUGGUACCAAUCAUUCCA	ath-miR4227	AT1G43005.1	2.5	FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G61060.1); Has 259 Blast hits to 220 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 259; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
53	ath-MIR4239	ath-miR4239	UUUGUUAUUUUCGCAUGCUCC	ath-miR4239	AT5G14860.1	2	UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: central cell; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213), Tudor subgroup (InterPro:IPR018351); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (TAIR:AT2G16890.2); Has 7679 Blast hits to 7613 proteins in 497 species: Archae - 0; Bacteria - 501; Metazoa - 1984; Fungi - 34; Plants - 4971; Viruses - 133; Other Eukaryotes - 56 (source: NCBI BLink).
54	ath-MIR4243	ath-miR4243	UUGAAAUUGUAGAUUUCGUAC	ath-miR4243	AT2G38590.1	2	F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT4G33290.1); Has 1437 Blast hits to 1364 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1435; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
54	ath-MIR4243	ath-miR4243	UUGAAAUUGUAGAUUUCGUAC	ath-miR4243	AT3G13830.1	1	F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box associated ubiquitination effector family protein (TAIR:AT1G11810.1); Has 1011 Blast hits to 960 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1011; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
55	ath-MIR426	ath-miR426	UUUUGGAAAUUUGUCCUUACG	ath-miR426	AT5G04860.1	3	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11760.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
56	ath-MIR447c	ath-miR447c	UUGGGGACGACAUCUUUUGUUG	ath-miR447c	AT1G16300.1	3	glyceraldehyde-3-phosphate dehydrogenase of plastid 2 (GAPCP-2); CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase subfamily (InterPro:IPR000173), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (InterPro:IPR020829), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain, subgroup (InterPro:IPR020832), Glyceraldehyde 3-phosphate dehydrogenase, active site (InterPro:IPR020830), Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (InterPro:IPR020828); BEST Arabidopsis thaliana protein match is: glyceraldehyde-3-phosphate dehydrogenase of plastid 1 (TAIR:AT1G79530.1); Has 25238 Blast hits to 25227 proteins in 6343 species: Archae - 51; Bacteria - 10898; Metazoa - 2382; Fungi - 2852; Plants - 3834; Viruses - 0; Other Eukaryotes - 5221 (source: NCBI BLink).
56	ath-MIR447c	ath-miR447c	UUGGGGACGACAUCUUUUGUUG	ath-miR447c	AT5G66760.1	3	succinate dehydrogenase 1-1 (SDH1-1); FUNCTIONS IN: cobalt ion binding, succinate dehydrogenase activity, ATP binding; INVOLVED IN: mitochondrial electron transport, succinate to ubiquinone; LOCATED IN: mitochondrial respiratory chain complex II, mitochondrion, cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Succinate dehydrogenase, flavoprotein subunit (InterPro:IPR011281), Fumarate reductase/succinate dehydrogenase, FAD-binding site (InterPro:IPR003952), Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (InterPro:IPR015939), Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (InterPro:IPR003953), Succinate dehydrogenase/fumarate reductase, flavoprotein subunit (InterPro:IPR014006), Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (InterPro:IPR004112); BEST Arabidopsis thaliana protein match is: succinate dehydrogenase 1-2 (TAIR:AT2G18450.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
57	ath-MIR472	ath-miR472	UUUUUCCUACUCCGCCCAUACC	ath-miR472	AT5G05400.1	3	LRR and NB-ARC domains-containing disease resistance protein; FUNCTIONS IN: ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: chloroplast; EXPRESSED IN: stem, root; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance protein (InterPro:IPR000767); BEST Arabidopsis thaliana protein match is: Disease resistance protein (CC-NBS-LRR class) family (TAIR:AT5G63020.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
58	ath-MIR5012	ath-miR5012	UUUUACUGCUACUUGUGUUCC	ath-miR5012	AT5G58870.1	3	FTSH protease 9 (ftsh9); FUNCTIONS IN: metallopeptidase activity, ATP-dependent peptidase activity, ATPase activity; INVOLVED IN: proteolysis, protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M41, FtsH (InterPro:IPR005936), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41 (InterPro:IPR000642), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH protease 7 (TAIR:AT3G47060.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
59	ath-MIR5014a	ath-miR5014a-3p	UUGUACAAAUUUAAGUGUACG	ath-miR5014a-3p	AT4G29490.1	3	Metallopeptidase M24 family protein; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: Metallopeptidase M24 family protein (TAIR:AT1G09300.1); Has 11688 Blast hits to 11680 proteins in 2580 species: Archae - 275; Bacteria - 8182; Metazoa - 386; Fungi - 373; Plants - 96; Viruses - 0; Other Eukaryotes - 2376 (source: NCBI BLink).
60	ath-MIR5014b	ath-miR5014b	AUUUGUACACCUAGAUCUGUA	ath-miR5014b	AT1G73750.1	3	Uncharacterised conserved protein UCP031088, alpha/beta hydrolase; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase (TAIR:AT1G15060.1); Has 187 Blast hits to 154 proteins in 46 species: Archae - 0; Bacteria - 64; Metazoa - 8; Fungi - 0; Plants - 107; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
61	ath-MIR5015	ath-miR5015	UUGGUGUUAUGUGUAGUCUUC	ath-miR5015	AT3G29230.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G29760.1); Has 41738 Blast hits to 14344 proteins in 280 species: Archae - 0; Bacteria - 4; Metazoa - 166; Fungi - 161; Plants - 40664; Viruses - 0; Other Eukaryotes - 743 (source: NCBI BLink).
62	ath-MIR5016	ath-miR5016	UUCUUGUGGAUUCCUUGGAAA	ath-miR5016	AT1G21650.1	3	Preprotein translocase SecA family protein; FUNCTIONS IN: ATPase activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein transport by the Sec complex, protein import; LOCATED IN: internal side of plasma membrane, chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecA, preprotein translocase (InterPro:IPR022491), SecA motor DEAD (InterPro:IPR014018), SecA Wing/Scaffold (InterPro:IPR011116), SecA preprotein, cross-linking domain (InterPro:IPR011130), SecA conserved site (InterPro:IPR020937), SecA DEAD-like (InterPro:IPR011115), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: Albino or Glassy Yellow 1 (TAIR:AT4G01800.1); Has 21976 Blast hits to 13078 proteins in 2820 species: Archae - 0; Bacteria - 13647; Metazoa - 53; Fungi - 1; Plants - 97; Viruses - 0; Other Eukaryotes - 8178 (source: NCBI BLink).
					AT1G21650.2	3	Preprotein translocase SecA family protein; FUNCTIONS IN: ATPase activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein import, protein transport by the Sec complex; LOCATED IN: internal side of plasma membrane, chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecA Wing/Scaffold (InterPro:IPR011116), SecA preprotein, cross-linking domain (InterPro:IPR011130), SecA, preprotein translocase (InterPro:IPR022491), SecA DEAD-like (InterPro:IPR011115), SecA conserved site (InterPro:IPR020937), SecA motor DEAD (InterPro:IPR014018), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: Albino or Glassy Yellow 1 (TAIR:AT4G01800.1).
					AT1G21650.3	3	Preprotein translocase SecA family protein; FUNCTIONS IN: ATPase activity, zinc ion binding, P-P-bond-hydrolysis-driven protein transmembrane transporter activity, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein transport by the Sec complex, protein import; LOCATED IN: internal side of plasma membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), Zinc finger, RING-type (InterPro:IPR001841), SecA, preprotein translocase (InterPro:IPR022491), WD40 repeat (InterPro:IPR001680), SecA motor DEAD (InterPro:IPR014018), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), SecA Wing/Scaffold (InterPro:IPR011116), WD40-repeat-containing domain (InterPro:IPR017986), SecA preprotein, cross-linking domain (InterPro:IPR011130), SecA DEAD-like (InterPro:IPR011115), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), SecA conserved site (InterPro:IPR020937), WD40 repeat, subgroup (InterPro:IPR019781), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G21651.1).
					AT2G39705.1	3	ROTUNDIFOLIA like 8 (RTFL8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: shoot development; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); BEST Arabidopsis thaliana protein match is: ROTUNDIFOLIA like 7 (TAIR:AT3G55515.1); Has 171 Blast hits to 171 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
63	ath-MIR5020a	ath-miR5020a	UGGAAGAAGGUGAGACUUGCA	ath-miR5020a	AT5G09840.1	3	Putative endonuclease or glycosyl hydrolase; BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT5G64710.1); Has 416 Blast hits to 392 proteins in 63 species: Archae - 2; Bacteria - 5; Metazoa - 78; Fungi - 41; Plants - 277; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
64	ath-MIR5020b	ath-miR5020b	AUGGCAUGAAAGAAGGUGAGA	ath-miR5020b	AT4G19191.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G11290.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
65	ath-MIR5021	ath-miR5021	UGAGAAGAAGAAGAAGAAAA	ath-miR5021	AT3G22150.1	1.5	Tetratricopeptide repeat (TPR)-like superfamily protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT3G57430.1); Has 48288 Blast hits to 14244 proteins in 270 species: Archae - 2; Bacteria - 15; Metazoa - 107; Fungi - 102; Plants - 47393; Viruses - 0; Other Eukaryotes - 669 (source: NCBI BLink).
66	ath-MIR5029	ath-miR5029	AAUGAGAGAGAACACUGCAAA	ath-miR5029	AT2G37320.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: shoot apex, embryo, leaf whorl, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT3G24000.1); Has 40972 Blast hits to 13911 proteins in 248 species: Archae - 0; Bacteria - 4; Metazoa - 85; Fungi - 62; Plants - 40344; Viruses - 0; Other Eukaryotes - 477 (source: NCBI BLink).
67	ath-MIR5595a	ath-miR5595a	ACAUAUGAUCUGCAUCUUUGC	ath-miR5595a	AT2G23570.1	1	methyl esterase 19 (MES19); CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: methyl esterase 4 (TAIR:AT2G23580.1); Has 616 Blast hits to 615 proteins in 54 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 572; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
67	ath-MIR5595a	ath-miR5595a	ACAUAUGAUCUGCAUCUUUGC	ath-miR5595a	AT1G75690.1	3	DnaJ/Hsp40 cysteine-rich domain superfamily protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich domain (InterPro:IPR001305); Has 581 Blast hits to 563 proteins in 197 species: Archae - 4; Bacteria - 299; Metazoa - 12; Fungi - 21; Plants - 163; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).
68	ath-MIR5630a	ath-miR5630a	GCUAAGAGCGGUUCUGAUGGA	ath-miR5630a	AT4G09010.1	3	ascorbate peroxidase 4 (APX4); FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: oxidation reduction, response to oxidative stress; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant ascorbate peroxidase (InterPro:IPR002207), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: ascorbate peroxidase 5 (TAIR:AT4G35970.1); Has 1182 Blast hits to 1180 proteins in 264 species: Archae - 20; Bacteria - 119; Metazoa - 0; Fungi - 348; Plants - 604; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).
69	ath-MIR5630b	ath-miR5630b	GCUAAGAGCGGUUCUGAUGGA	ath-miR5630b	AT4G09010.1	3	ascorbate peroxidase 4 (APX4); FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: oxidation reduction, response to oxidative stress; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant ascorbate peroxidase (InterPro:IPR002207), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: ascorbate peroxidase 5 (TAIR:AT4G35970.1); Has 1182 Blast hits to 1180 proteins in 264 species: Archae - 20; Bacteria - 119; Metazoa - 0; Fungi - 348; Plants - 604; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).
70	ath-MIR5631	ath-miR5631	UGGCAGGAAAGACAUAAUUUU	ath-miR5631	AT2G20540.1	3	mitochondrial editing factor 21 (MEF21); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G56310.1); Has 36443 Blast hits to 13667 proteins in 251 species: Archae - 0; Bacteria - 21; Metazoa - 39; Fungi - 110; Plants - 35693; Viruses - 0; Other Eukaryotes - 580 (source: NCBI BLink).
71	ath-MIR5636	ath-miR5636	CGUAGUUGCAGAGCUUGACGG	ath-miR5636	AT2G21330.1	2	fructose-bisphosphate aldolase 1 (FBA1); FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase 2 (TAIR:AT4G38970.1); Has 4798 Blast hits to 4794 proteins in 909 species: Archae - 0; Bacteria - 735; Metazoa - 1150; Fungi - 8; Plants - 476; Viruses - 0; Other Eukaryotes - 2429 (source: NCBI BLink).
					AT2G21330.2	2	fructose-bisphosphate aldolase 1 (FBA1); FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase 2 (TAIR:AT4G38970.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
					AT2G21330.3	2	fructose-bisphosphate aldolase 1 (FBA1); FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase 2 (TAIR:AT4G38970.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
					AT4G34090.1	3	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
					AT4G34090.3	3	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1).
72	ath-MIR5639	ath-miR5639	UAGUCCACUGUGGUCUAAGGC	ath-miR5639	AT1G77360.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G71060.1); Has 41021 Blast hits to 13124 proteins in 297 species: Archae - 2; Bacteria - 34; Metazoa - 347; Fungi - 738; Plants - 38768; Viruses - 0; Other Eukaryotes - 1132 (source: NCBI BLink).
73	ath-MIR5640	ath-miR5640	UGAGAGAAGGAAUUAGAUUCA	ath-miR5640	AT3G20330.1	2.5	aspartate carbamoyltransferase; PYRIMIDINE B (PYRB); FUNCTIONS IN: amino acid binding, protein binding, aspartate carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: cellular response to phosphate starvation, pyrimidine ribonucleotide biosynthetic process, cellular amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate carbamoyltransferase, eukaryotic (InterPro:IPR002082), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding domain (InterPro:IPR006131); BEST Arabidopsis thaliana protein match is: ornithine carbamoyltransferase (TAIR:AT1G75330.1); Has 16843 Blast hits to 16841 proteins in 2894 species: Archae - 534; Bacteria - 10902; Metazoa - 218; Fungi - 284; Plants - 116; Viruses - 6; Other Eukaryotes - 4783 (source: NCBI BLink).
74	ath-MIR5641	ath-miR5641	UGGAAGAAGAUGAUAGAAUUA	ath-miR5641	AT1G22680.1	3	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF688 (InterPro:IPR007789); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71970.1); Has 44 Blast hits to 44 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
					AT4G24830.1	2.5	arginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 8298 Blast hits to 8290 proteins in 2389 species: Archae - 194; Bacteria - 4604; Metazoa - 152; Fungi - 155; Plants - 73; Viruses - 0; Other Eukaryotes - 3120 (source: NCBI BLink).
					AT4G24830.2	2.5	arginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
75	ath-MIR5643a	ath-miR5643a	AGGCUUUUAAGAUCUGGUUGC	ath-miR5643a	AT1G24270.1	1.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13090.1); Has 84 Blast hits to 83 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
76	ath-MIR5643b	ath-miR5643b	AGGCUUUUAAGAUCUGGUUGC	ath-miR5643b	AT1G24270.1	1.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13090.1); Has 84 Blast hits to 83 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
77	ath-MIR5644	ath-miR5644	GUGGGUUGCGGAUAACGGUA	ath-miR5644	AT4G02510.1	2.5	translocon at the outer envelope membrane of chloroplasts 159 (TOC159); FUNCTIONS IN: transmembrane receptor activity, GTPase activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, cytosol, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: multimeric translocon complex in the outer envelope membrane 132 (TAIR:AT2G16640.1); Has 20720 Blast hits to 13966 proteins in 1613 species: Archae - 439; Bacteria - 5942; Metazoa - 6041; Fungi - 2379; Plants - 1534; Viruses - 151; Other Eukaryotes - 4234 (source: NCBI BLink).
78	ath-MIR5645a	ath-miR5645a	AUUUGAGUCAUGUCGUUAAG	ath-miR5645a	AT4G01380.1	3	plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: copper ion binding;electron carriers (TAIR:AT1G45063.2); Has 1293 Blast hits to 1200 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1293; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
78	ath-MIR5645a	ath-miR5645a	AUUUGAGUCAUGUCGUUAAG	ath-miR5645a	AT4G33680.1	3	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein; ABERRANT GROWTH AND DEATH 2 (AGD2); FUNCTIONS IN: transaminase activity, copper ion binding, L,L-diaminopimelate aminotransferase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate, systemic acquired resistance, salicylic acid mediated signaling pathway; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: LL-diaminopimelate aminotransferase, plant-related (InterPro:IPR019942), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: AGD2-like defense response protein 1 (TAIR:AT2G13810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
79	ath-MIR5645b	ath-miR5645b	AUUUGAGUCAUGUCGUUAAG	ath-miR5645b	AT4G01380.1	3	plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: copper ion binding;electron carriers (TAIR:AT1G45063.2); Has 1293 Blast hits to 1200 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1293; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
79	ath-MIR5645b	ath-miR5645b	AUUUGAGUCAUGUCGUUAAG	ath-miR5645b	AT4G33680.1	3	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein; ABERRANT GROWTH AND DEATH 2 (AGD2); FUNCTIONS IN: transaminase activity, copper ion binding, L,L-diaminopimelate aminotransferase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate, systemic acquired resistance, salicylic acid mediated signaling pathway; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: LL-diaminopimelate aminotransferase, plant-related (InterPro:IPR019942), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: AGD2-like defense response protein 1 (TAIR:AT2G13810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
80	ath-MIR5645c	ath-miR5645c	AACCUAUUUAACGACAUGACU	ath-miR5645c	AT1G79490.1	3	PPR protein; embryo defective 2217 (EMB2217); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Smr protein/MutS2 C-terminal (InterPro:IPR002625); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G18900.2); Has 41590 Blast hits to 13375 proteins in 298 species: Archae - 1; Bacteria - 51; Metazoa - 349; Fungi - 749; Plants - 39263; Viruses - 0; Other Eukaryotes - 1177 (source: NCBI BLink).
81	ath-MIR5645d	ath-miR5645d	AUUUGAGUCAUGUCGUUAAG	ath-miR5645d	AT4G01380.1	3	plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: copper ion binding;electron carriers (TAIR:AT1G45063.2); Has 1293 Blast hits to 1200 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1293; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
81	ath-MIR5645d	ath-miR5645d	AUUUGAGUCAUGUCGUUAAG	ath-miR5645d	AT4G33680.1	3	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein; ABERRANT GROWTH AND DEATH 2 (AGD2); FUNCTIONS IN: transaminase activity, copper ion binding, L,L-diaminopimelate aminotransferase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate, systemic acquired resistance, salicylic acid mediated signaling pathway; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: LL-diaminopimelate aminotransferase, plant-related (InterPro:IPR019942), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: AGD2-like defense response protein 1 (TAIR:AT2G13810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
82	ath-MIR5645e	ath-miR5645e	AUUUGAGUCAUGUCGUUAAG	ath-miR5645e	AT4G01380.1	3	plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: copper ion binding;electron carriers (TAIR:AT1G45063.2); Has 1293 Blast hits to 1200 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1293; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
82	ath-MIR5645e	ath-miR5645e	AUUUGAGUCAUGUCGUUAAG	ath-miR5645e	AT4G33680.1	3	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein; ABERRANT GROWTH AND DEATH 2 (AGD2); FUNCTIONS IN: transaminase activity, copper ion binding, L,L-diaminopimelate aminotransferase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate, systemic acquired resistance, salicylic acid mediated signaling pathway; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: LL-diaminopimelate aminotransferase, plant-related (InterPro:IPR019942), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: AGD2-like defense response protein 1 (TAIR:AT2G13810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
83	ath-MIR5645f	ath-miR5645f	AUUUGAGUCAUGUCGUUAAG	ath-miR5645f	AT4G01380.1	3	plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: copper ion binding;electron carriers (TAIR:AT1G45063.2); Has 1293 Blast hits to 1200 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1293; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
83	ath-MIR5645f	ath-miR5645f	AUUUGAGUCAUGUCGUUAAG	ath-miR5645f	AT4G33680.1	3	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein; ABERRANT GROWTH AND DEATH 2 (AGD2); FUNCTIONS IN: transaminase activity, copper ion binding, L,L-diaminopimelate aminotransferase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate, systemic acquired resistance, salicylic acid mediated signaling pathway; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: LL-diaminopimelate aminotransferase, plant-related (InterPro:IPR019942), Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Aminotransferase, class I/classII (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: AGD2-like defense response protein 1 (TAIR:AT2G13810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
84	ath-MIR5648	ath-miR5648-3p	AUCUGAAGAAAAUAGCGGCAU	ath-miR5648-3p	AT2G23820.2	3	Metal-dependent phosphohydrolase; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Metal-dependent phosphohydrolase, HD subdomain (InterPro:IPR006674), Metal-dependent phosphohydrolase, HD domain (InterPro:IPR003607); BEST Arabidopsis thaliana protein match is: Metal-dependent phosphohydrolase (TAIR:AT1G26160.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
84	ath-MIR5648	ath-miR5648-3p	AUCUGAAGAAAAUAGCGGCAU	ath-miR5648-3p	AT3G05350.1	2.5	Metallopeptidase M24 family protein; FUNCTIONS IN: hydrolase activity, aminopeptidase activity; INVOLVED IN: proteolysis, cellular process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24, structural domain (InterPro:IPR000994), Creatinase (InterPro:IPR000587); BEST Arabidopsis thaliana protein match is: aminopeptidase P1 (TAIR:AT4G36760.1); Has 11788 Blast hits to 11217 proteins in 2602 species: Archae - 275; Bacteria - 7526; Metazoa - 334; Fungi - 310; Plants - 154; Viruses - 0; Other Eukaryotes - 3189 (source: NCBI BLink).
85	ath-MIR5649a	ath-miR5649a	AUUGAAUAUGUUGGUUACUAU	ath-miR5649a	AT1G76280.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: genomes uncoupled 1 (TAIR:AT2G31400.1); Has 14296 Blast hits to 5357 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 31; Fungi - 37; Plants - 13843; Viruses - 0; Other Eukaryotes - 383 (source: NCBI BLink).
					AT1G76280.2	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G18940.1); Has 12686 Blast hits to 5224 proteins in 153 species: Archae - 1; Bacteria - 0; Metazoa - 27; Fungi - 31; Plants - 12255; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).
					AT1G76280.3	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: genomes uncoupled 1 (TAIR:AT2G31400.1).
86	ath-MIR5649b	ath-miR5649b	AUUGAAUAUGUUGGUUACUAU	ath-miR5649b	AT1G76280.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: genomes uncoupled 1 (TAIR:AT2G31400.1); Has 14296 Blast hits to 5357 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 31; Fungi - 37; Plants - 13843; Viruses - 0; Other Eukaryotes - 383 (source: NCBI BLink).
					AT1G76280.2	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G18940.1); Has 12686 Blast hits to 5224 proteins in 153 species: Archae - 1; Bacteria - 0; Metazoa - 27; Fungi - 31; Plants - 12255; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).
					AT1G76280.3	3	Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: genomes uncoupled 1 (TAIR:AT2G31400.1).
87	ath-MIR5650	ath-miR5650	UUGUUUUGGAUCUUAGAUACA	ath-miR5650	AT4G14850.1	3	PPR protein; lovastatin insensitive 1 (LOI1); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G09950.1); Has 35457 Blast hits to 13266 proteins in 222 species: Archae - 0; Bacteria - 4; Metazoa - 55; Fungi - 21; Plants - 34914; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink).
88	ath-MIR5652	ath-miR5652	UUGAAUGUGAAUGAAUCGGGC	ath-miR5652	AT1G63130.1	0	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G62910.1); Has 68218 Blast hits to 15140 proteins in 318 species: Archae - 7; Bacteria - 75; Metazoa - 1255; Fungi - 1382; Plants - 62771; Viruses - 0; Other Eukaryotes - 2728 (source: NCBI BLink).
					AT2G43945.1	2.5	unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59870.1); Has 292 Blast hits to 292 proteins in 84 species: Archae - 0; Bacteria - 122; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).
					AT4G31780.1	3	monogalactosyl diacylglycerol synthase 1 (MGD1); FUNCTIONS IN: UDP-glycosyltransferase activity, 1,2-diacylglycerol 3-beta-galactosyltransferase activity, transferase activity, transferring glycosyl groups, UDP-galactosyltransferase activity; INVOLVED IN: thylakoid membrane organization, glycolipid biosynthetic process, galactolipid biosynthetic process, embryo development; LOCATED IN: chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Monogalactosyldiacylglycerol synthase (InterPro:IPR009695), Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); BEST Arabidopsis thaliana protein match is: monogalactosyldiacylglycerol synthase type C (TAIR:AT2G11810.1); Has 1828 Blast hits to 1828 proteins in 656 species: Archae - 0; Bacteria - 1628; Metazoa - 0; Fungi - 0; Plants - 105; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).
					AT4G31780.2	3	monogalactosyl diacylglycerol synthase 1 (MGD1); FUNCTIONS IN: UDP-glycosyltransferase activity, 1,2-diacylglycerol 3-beta-galactosyltransferase activity, transferase activity, transferring glycosyl groups, UDP-galactosyltransferase activity; INVOLVED IN: thylakoid membrane organization, glycolipid biosynthetic process, galactolipid biosynthetic process, embryo development; LOCATED IN: chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235), Monogalactosyldiacylglycerol synthase (InterPro:IPR009695); BEST Arabidopsis thaliana protein match is: monogalactosyldiacylglycerol synthase type C (TAIR:AT2G11810.1); Has 2406 Blast hits to 2406 proteins in 811 species: Archae - 0; Bacteria - 2169; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).
89	ath-MIR5653	ath-miR5653	UGGGUUGAGUUGAGUUGAGUUGGC	ath-miR5653	AT5G25752.1	3	rhomboid-like protein 11 (RBL11); FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610); BEST Arabidopsis thaliana protein match is: Rhomboid-related intramembrane serine protease family protein (TAIR:AT5G25640.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
90	ath-MIR5654	ath-miR5654	AUAAAUCCCAACAUCUUCCA	ath-miR5654	AT1G12300.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G12775.1); Has 69404 Blast hits to 15469 proteins in 318 species: Archae - 6; Bacteria - 74; Metazoa - 1057; Fungi - 1243; Plants - 64555; Viruses - 0; Other Eukaryotes - 2469 (source: NCBI BLink).
					AT1G12620.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G12300.1); Has 65829 Blast hits to 15121 proteins in 316 species: Archae - 4; Bacteria - 59; Metazoa - 1157; Fungi - 1233; Plants - 61014; Viruses - 0; Other Eukaryotes - 2362 (source: NCBI BLink).
					AT1G12775.1	3	Pentatricopeptide repeat (PPR) superfamily protein; LOCATED IN: mitochondrion; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G12300.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
					AT1G16830.1	3	Pentatricopeptide repeat (PPR) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT3G53700.1); Has 39592 Blast hits to 12738 proteins in 255 species: Archae - 3; Bacteria - 24; Metazoa - 191; Fungi - 211; Plants - 38370; Viruses - 0; Other Eukaryotes - 793 (source: NCBI BLink).
					AT5G06340.1	2.5	nudix hydrolase homolog 27 (NUDX27); CONTAINS InterPro DOMAIN/s: NUDIX hydrolase domain-like (InterPro:IPR015797), NUDIX hydrolase (InterPro:IPR020476), NUDIX hydrolase, conserved site (InterPro:IPR020084), NUDIX hydrolase domain (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: nudix hydrolase homolog 26 (TAIR:AT3G10620.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
91	ath-MIR5655	ath-miR5655	AAGUAGACACAUAAGAAGGAG	ath-miR5655	AT1G33350.1	3	Pentatricopeptide repeat (PPR) superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: C globular stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: mitochondrial editing factor 21 (TAIR:AT2G20540.1); Has 34946 Blast hits to 13536 proteins in 257 species: Archae - 4; Bacteria - 29; Metazoa - 79; Fungi - 56; Plants - 34238; Viruses - 0; Other Eukaryotes - 540 (source: NCBI BLink).
92	ath-MIR5656	ath-miR5656	ACUGAAGUAGAGAUUGGGUUU	ath-miR5656	AT1G62260.1	2.5	mitochondrial editing factor 9 (MEF9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cytidine to uridine editing; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G02750.1); Has 48341 Blast hits to 14172 proteins in 260 species: Archae - 3; Bacteria - 22; Metazoa - 134; Fungi - 182; Plants - 47365; Viruses - 0; Other Eukaryotes - 635 (source: NCBI BLink).
92	ath-MIR5656	ath-miR5656	ACUGAAGUAGAGAUUGGGUUU	ath-miR5656	ATMG00160.1	3	cytochrome oxidase 2 (COX2); FUNCTIONS IN: cytochrome-c oxidase activity; INVOLVED IN: respiratory electron transport chain; LOCATED IN: mitochondrion, chloroplast, mitochondrial respiratory chain complex IV; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome C oxidase subunit II-like, transmembrane domain (InterPro:IPR015964), Cytochrome c oxidase subunit II C-terminal (InterPro:IPR002429), Cupredoxin (InterPro:IPR008972), Cytochrome c oxidase, subunit II (InterPro:IPR014222), Cytochrome C oxidase subunit II, transmembrane domain (InterPro:IPR011759); BEST Arabidopsis thaliana protein match is: Cytochrome C oxidase subunit II-like, transmembrane domain (TAIR:ATMG01280.1).
93	ath-MIR5657	ath-miR5657	UGGACAAGGUUAGAUUUGGUG	ath-miR5657	AT5G27660.1	0	Trypsin family protein with PDZ domain; FUNCTIONS IN: serine-type peptidase activity, catalytic activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Serine/cysteine peptidase, trypsin-like (InterPro:IPR009003), Peptidase S1C, HrtA/DegP2/Q/S (InterPro:IPR001940), Peptidase S1/S6, chymotrypsin/Hap (InterPro:IPR001254), PDZ/DHR/GLGF (InterPro:IPR001478); BEST Arabidopsis thaliana protein match is: DegP protease 1 (TAIR:AT3G27925.1); Has 16463 Blast hits to 16423 proteins in 2614 species: Archae - 115; Bacteria - 10782; Metazoa - 377; Fungi - 151; Plants - 529; Viruses - 0; Other Eukaryotes - 4509 (source: NCBI BLink).
94	ath-MIR5658	ath-miR5658	AUGAUGAUGAUGAUGAUGAAA	ath-miR5658	AT2G21530.1	0	SMAD/FHA domain-containing protein ; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (FHA) domain (InterPro:IPR000253); Has 459 Blast hits to 455 proteins in 163 species: Archae - 26; Bacteria - 275; Metazoa - 3; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
					AT2G37410.1	0	translocase inner membrane subunit 17-2 (TIM17-2); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport, protein import into mitochondrial inner membrane; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial inner membrane translocase complex, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: translocase inner membrane subunit 17-1 (TAIR:AT1G20350.1); Has 2051 Blast hits to 1654 proteins in 249 species: Archae - 0; Bacteria - 134; Metazoa - 977; Fungi - 256; Plants - 141; Viruses - 2; Other Eukaryotes - 541 (source: NCBI BLink).
					AT2G37410.2	0	translocase inner membrane subunit 17-2 (TIM17-2); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport, protein import into mitochondrial inner membrane; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial inner membrane translocase complex, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: translocase inner membrane subunit 17-1 (TAIR:AT1G20350.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
95	ath-MIR5661	ath-miR5661	AGAGGUACAUCAUGUAGUCUG	ath-miR5661	AT4G19080.1	0	Protein of unknown function (DUF594); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF594 (InterPro:IPR007658); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF594) (TAIR:AT5G45540.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
96	ath-MIR5662	ath-miR5662	AGAGGUGACCAUUGGAGAUG	ath-miR5662	AT1G12130.1	3	Flavin-binding monooxygenase family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: oxidation reduction; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960), Flavin-containing monooxygenase-like (InterPro:IPR020946); BEST Arabidopsis thaliana protein match is: Flavin-binding monooxygenase family protein (TAIR:AT1G12160.1); Has 14567 Blast hits to 13953 proteins in 1841 species: Archae - 71; Bacteria - 7478; Metazoa - 1324; Fungi - 1597; Plants - 844; Viruses - 0; Other Eukaryotes - 3253 (source: NCBI BLink).
97	ath-MIR5663	ath-miR5663	AGCUAAGGAUUUGCAUUCUCA	ath-miR5663	AT4G28010.1	3	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: rna processing factor 2 (TAIR:AT1G62670.1); Has 64686 Blast hits to 15009 proteins in 313 species: Archae - 9; Bacteria - 69; Metazoa - 819; Fungi - 1094; Plants - 60516; Viruses - 0; Other Eukaryotes - 2179 (source: NCBI BLink).
97	ath-MIR5663	ath-miR5663	AGCUAAGGAUUUGCAUUCUCA	ath-miR5663	AT4G30060.1	2.5	Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein; CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); BEST Arabidopsis thaliana protein match is: Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT2G19160.1); Has 603 Blast hits to 603 proteins in 26 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 557; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
98	ath-MIR5664	ath-miR5664	AUAGUCAAUUUUAUCGGUCUG	ath-miR5664	AT1G50030.1	2.5	family of phosphatidylinositol 3-kinase; target of rapamycin (TOR); FUNCTIONS IN: protein binding, 1-phosphatidylinositol-3-kinase activity; INVOLVED IN: embryo development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403), Armadillo-like helical (InterPro:IPR011989), FKBP12-rapamycin-associated protein, FKBP12-rapamycin-binding (InterPro:IPR009076), Protein kinase-like domain (InterPro:IPR011009), PIK-related kinase, FAT (InterPro:IPR003151), PIK-related kinase (InterPro:IPR014009), Armadillo-type fold (InterPro:IPR016024), PIK-related kinase, FATC (InterPro:IPR003152), Phosphatidylinositol 3/4-kinase, conserved site (InterPro:IPR018936); BEST Arabidopsis thaliana protein match is: Ataxia telangiectasia-mutated and RAD3-related (TAIR:AT5G40820.1); Has 4645 Blast hits to 4114 proteins in 299 species: Archae - 0; Bacteria - 46; Metazoa - 1929; Fungi - 1123; Plants - 507; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink).
98	ath-MIR5664	ath-miR5664	AUAGUCAAUUUUAUCGGUCUG	ath-miR5664	AT1G50030.2	2.5	target of rapamycin (TOR); FUNCTIONS IN: protein binding, 1-phosphatidylinositol-3-kinase activity; INVOLVED IN: embryo development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403), FKBP12-rapamycin-associated protein, FKBP12-rapamycin-binding (InterPro:IPR009076), Armadillo-like helical (InterPro:IPR011989), Protein kinase-like domain (InterPro:IPR011009), PIK-related kinase, FAT (InterPro:IPR003151), PIK-related kinase (InterPro:IPR014009), Armadillo-type fold (InterPro:IPR016024), Phosphatidylinositol 3/4-kinase, conserved site (InterPro:IPR018936), PIK-related kinase, FATC (InterPro:IPR003152); BEST Arabidopsis thaliana protein match is: Ataxia telangiectasia-mutated and RAD3-related (TAIR:AT5G40820.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
99	ath-MIR5995b	ath-miR5995b	ACAUAUGAUCUGCAUCUUUGC	ath-miR5995b	AT1G75690.1	3	DnaJ/Hsp40 cysteine-rich domain superfamily protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich domain (InterPro:IPR001305); Has 581 Blast hits to 563 proteins in 197 species: Archae - 4; Bacteria - 299; Metazoa - 12; Fungi - 21; Plants - 163; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).
99	ath-MIR5995b	ath-miR5995b	ACAUAUGAUCUGCAUCUUUGC	ath-miR5995b	AT2G23570.1	1	methyl esterase 19 (MES19); CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: methyl esterase 4 (TAIR:AT2G23580.1); Has 616 Blast hits to 615 proteins in 54 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 572; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
100	ath-MIR5998a	ath-miR5998a	ACAGUUUGUGUUUUGUUUUGU	ath-miR5998a	AT3G25740.1	2.5	methionine aminopeptidase 1C (MAP1B); FUNCTIONS IN: metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, N-terminal protein amino acid modification; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24A, methionine aminopeptidase, subfamily 1 (InterPro:IPR002467), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714);
					AT4G33010.1	2.5	glycine decarboxylase P-protein 1 (GLDP1); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, protein binding; INVOLVED IN: glycine catabolic process, response to cadmium ion, glycine decarboxylation via glycine cleavage system; LOCATED IN: mitochondrion, apoplast, glycine cleavage complex, chloroplast, chloroplast envelope; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Glycine cleavage system P-protein (InterPro:IPR003437), Glycine cleavage system P-protein-like (InterPro:IPR020581), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine cleavage system P-protein, N-terminal (InterPro:IPR020580); BEST Arabidopsis thaliana protein match is: glycine decarboxylase P-protein 2 (TAIR:AT2G26080.1); Has 12463 Blast hits to 11454 proteins in 1943 species: Archae - 255; Bacteria - 5318; Metazoa - 139; Fungi - 214; Plants - 99; Viruses - 0; Other Eukaryotes - 6438 (source: NCBI BLink).
					AT4G33010.2	2.5	glycine decarboxylase P-protein 1 (GLDP1); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, protein binding; INVOLVED IN: glycine catabolic process, response to cadmium ion, glycine decarboxylation via glycine cleavage system; LOCATED IN: mitochondrion, apoplast, glycine cleavage complex, chloroplast; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Glycine cleavage system P-protein-like (InterPro:IPR020581), Glycine cleavage system P-protein (InterPro:IPR003437), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine cleavage system P-protein, N-terminal (InterPro:IPR020580); BEST Arabidopsis thaliana protein match is: glycine decarboxylase P-protein 2 (TAIR:AT2G26080.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
101	ath-MIR5998b	ath-miR5998b	ACAGUUUGUGUUUUGUUUUGU	ath-miR5998b	AT3G25740.1	2.5	methionine aminopeptidase 1C (MAP1B); FUNCTIONS IN: metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, N-terminal protein amino acid modification; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24A, methionine aminopeptidase, subfamily 1 (InterPro:IPR002467), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714);
					AT4G33010.1	2.5	glycine decarboxylase P-protein 1 (GLDP1); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, protein binding; INVOLVED IN: glycine catabolic process, response to cadmium ion, glycine decarboxylation via glycine cleavage system; LOCATED IN: mitochondrion, apoplast, glycine cleavage complex, chloroplast, chloroplast envelope; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Glycine cleavage system P-protein (InterPro:IPR003437), Glycine cleavage system P-protein-like (InterPro:IPR020581), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine cleavage system P-protein, N-terminal (InterPro:IPR020580); BEST Arabidopsis thaliana protein match is: glycine decarboxylase P-protein 2 (TAIR:AT2G26080.1); Has 12463 Blast hits to 11454 proteins in 1943 species: Archae - 255; Bacteria - 5318; Metazoa - 139; Fungi - 214; Plants - 99; Viruses - 0; Other Eukaryotes - 6438 (source: NCBI BLink).
					AT4G33010.2	2.5	glycine decarboxylase P-protein 1 (GLDP1); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, protein binding; INVOLVED IN: glycine catabolic process, response to cadmium ion, glycine decarboxylation via glycine cleavage system; LOCATED IN: mitochondrion, apoplast, glycine cleavage complex, chloroplast; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major domain (InterPro:IPR015424), Glycine cleavage system P-protein-like (InterPro:IPR020581), Glycine cleavage system P-protein (InterPro:IPR003437), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine cleavage system P-protein, N-terminal (InterPro:IPR020580); BEST Arabidopsis thaliana protein match is: glycine decarboxylase P-protein 2 (TAIR:AT2G26080.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
102	ath-MIR773a	ath-miR773a	UUUGCUUCCAGCUUUUGUCUC	ath-miR773a	AT1G30160.2	3	Protein of unknown function (DUF295); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF295) (TAIR:AT1G05540.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
102	ath-MIR773a	ath-miR773a	UUUGCUUCCAGCUUUUGUCUC	ath-miR773a	AT4G05390.1	2	root-type ferredoxin:NADP(H) oxidoreductase; root FNR 1 (RFNR1); FUNCTIONS IN: oxidoreductase activity, copper ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Oxidoreductase, FAD-binding domain (InterPro:IPR008333), Ferredoxin--NADP reductase (InterPro:IPR012146), Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Ferredoxin Reductase (InterPro:IPR015701), Flavoprotein pyridine nucleotide cytochrome reductase (InterPro:IPR001709); BEST Arabidopsis thaliana protein match is: root FNR 2 (TAIR:AT1G30510.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
103	ath-MIR773b	ath-miR773b-3p	UUUGAUUCCAGCUUUUGUCUC	ath-miR773b-3p	AT1G16300.1	2.5	glyceraldehyde-3-phosphate dehydrogenase of plastid 2 (GAPCP-2); CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase subfamily (InterPro:IPR000173), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (InterPro:IPR020829), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain, subgroup (InterPro:IPR020832), Glyceraldehyde 3-phosphate dehydrogenase, active site (InterPro:IPR020830), Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (InterPro:IPR020828); BEST Arabidopsis thaliana protein match is: glyceraldehyde-3-phosphate dehydrogenase of plastid 1 (TAIR:AT1G79530.1); Has 25238 Blast hits to 25227 proteins in 6343 species: Archae - 51; Bacteria - 10898; Metazoa - 2382; Fungi - 2852; Plants - 3834; Viruses - 0; Other Eukaryotes - 5221 (source: NCBI BLink).
103	ath-MIR773b	ath-miR773b-3p	UUUGAUUCCAGCUUUUGUCUC	ath-miR773b-3p	AT1G79530.1	2.5	glyceraldehyde-3-phosphate dehydrogenase of plastid 1 (GAPCP-1); FUNCTIONS IN: glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, copper ion binding, glyceraldehyde-3-phosphate dehydrogenase activity, zinc ion binding; INVOLVED IN: in 6 processes; LOCATED IN: plastid, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase subfamily (InterPro:IPR000173), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (InterPro:IPR020829), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain, subgroup (InterPro:IPR020832), Glyceraldehyde 3-phosphate dehydrogenase, active site (InterPro:IPR020830), Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (InterPro:IPR020828); BEST Arabidopsis thaliana protein match is: glyceraldehyde-3-phosphate dehydrogenase of plastid 2 (TAIR:AT1G16300.1); Has 25337 Blast hits to 25325 proteins in 6357 species: Archae - 82; Bacteria - 10921; Metazoa - 2380; Fungi - 2852; Plants - 3837; Viruses - 0; Other Eukaryotes - 5265 (source: NCBI BLink).
104	ath-MIR774b	ath-miR774b-5p	UGAGAUGAAGAUAUGGGUGAU	ath-miR774b-5p	AT3G45300.1	3	isovaleryl-CoA-dehydrogenase (IVD); FUNCTIONS IN: isovaleryl-CoA dehydrogenase activity, ATP binding; INVOLVED IN: leucine catabolic process; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-CoA oxidase/dehydrogenase, type1/2, C-terminal (InterPro:IPR013764), Acyl-CoA oxidase/dehydrogenase, type 1 (InterPro:IPR006090), Acyl-CoA dehydrogenase/oxidase, N-terminal (InterPro:IPR013786), Acyl-CoA dehydrogenase/oxidase (InterPro:IPR009100), Acyl-CoA oxidase/dehydrogenase, central domain (InterPro:IPR006091), Acyl-CoA dehydrogenase, conserved site (InterPro:IPR006089), Acyl-CoA dehydrogenase/oxidase C-terminal (InterPro:IPR009075), Acyl-CoA dehydrogenase, N-terminal (InterPro:IPR006092); BEST Arabidopsis thaliana protein match is: acyl-CoA oxidase 4 (TAIR:AT3G51840.1); Has 45583 Blast hits to 45129 proteins in 2067 species: Archae - 559; Bacteria - 29477; Metazoa - 1687; Fungi - 835; Plants - 308; Viruses - 0; Other Eukaryotes - 12717 (source: NCBI BLink).
105	ath-MIR782	ath-miR782	ACAAACACCUUGGAUGUUCUU	ath-miR782	AT5G04360.1	3	limit dextrinase (LDA); FUNCTIONS IN: limit dextrinase activity, pullulanase activity, alpha-amylase activity; INVOLVED IN: starch biosynthetic process, carbohydrate metabolic process, starch catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,6-glucosidases, pullulanase-type (InterPro:IPR011839), Immunoglobulin E-set (InterPro:IPR014756), Glycoside hydrolase, family 13, N-terminal (InterPro:IPR004193), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic domain (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: isoamylase 3 (TAIR:AT4G09020.1); Has 6260 Blast hits to 6253 proteins in 1613 species: Archae - 73; Bacteria - 5462; Metazoa - 45; Fungi - 1; Plants - 262; Viruses - 0; Other Eukaryotes - 417 (source: NCBI BLink).
106	ath-MIR822	ath-miR822	UGCGGGAAGCAUUUGCACAUG	ath-miR822	AT4G13130.1	2.5	Cysteine/Histidine-rich C1 domain family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: leaf whorl, hypocotyl, root, pollen tube; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: Cysteine/Histidine-rich C1 domain family protein (TAIR:AT4G02540.1); Has 1641 Blast hits to 650 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 1630; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
107	ath-MIR823	ath-miR823	UGGGUGGUGAUCAUAUAAGAU	ath-miR823	AT1G76140.1	3	Prolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase, catalytic domain (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: Prolyl oligopeptidase family protein (TAIR:AT1G20380.1); Has 8127 Blast hits to 8050 proteins in 1368 species: Archae - 105; Bacteria - 3923; Metazoa - 339; Fungi - 43; Plants - 244; Viruses - 0; Other Eukaryotes - 3473 (source: NCBI BLink).
108	ath-MIR824	ath-miR824	UAGACCAUUUGUGAGAAGGGA	ath-miR824	AT5G55880.1	3	Protein of unknown function (DUF295); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF295) (TAIR:AT5G55890.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
108	ath-MIR824	ath-miR824	UAGACCAUUUGUGAGAAGGGA	ath-miR824	AT5G55890.1	3	Protein of unknown function (DUF295); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF295) (TAIR:AT5G55880.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
109	ath-MIR828	ath-miR828	UCUUGCUUAAAUGAGUAUUCCA	ath-miR828	AT1G74260.1	2.5	purine biosynthesis 4 (PUR4); FUNCTIONS IN: phosphoribosylformylglycinamidine synthase activity, catalytic activity, ATP binding; INVOLVED IN: microgametogenesis, pollen development; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PurM, N-terminal-like (InterPro:IPR016188), Phosphoribosylformylglycinamidine synthase, eukaryote/proteobacteria (InterPro:IPR010073), AIR synthase related protein (InterPro:IPR000728), AIR synthase related protein, C-terminal (InterPro:IPR010918), Glutamine amidotransferase type 1 (InterPro:IPR017926); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
109	ath-MIR828	ath-miR828	UCUUGCUUAAAUGAGUAUUCCA	ath-miR828	AT3G60980.1	2.5	Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: glutamine-rich protein 23 (TAIR:AT1G10270.1); Has 2028 Blast hits to 1422 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2019; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
110	ath-MIR832	ath-miR832-3p	UUGAUUCCCAAUCCAAGCAAG	ath-miR832-3p	AT4G30840.1	2	Transducin/WD40 repeat-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
111	ath-MIR833b	ath-miR833b	UGUUUGUUGACAUCGGUCUAG	ath-miR833b	AT2G03880.1	3	Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT3G24000.1); Has 41924 Blast hits to 14587 proteins in 276 species: Archae - 3; Bacteria - 26; Metazoa - 84; Fungi - 128; Plants - 40967; Viruses - 0; Other Eukaryotes - 716 (source: NCBI BLink).
112	ath-MIR834	ath-miR834	UGGUAGCAGUAGCGGUGGUAA	ath-miR834	AT3G52420.1	3	outer envelope membrane protein 7 (OEP7); Has 66 Blast hits to 66 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
112	ath-MIR834	ath-miR834	UGGUAGCAGUAGCGGUGGUAA	ath-miR834	AT5G01510.1	3	ROOT UV-B SENSITIVE 5 (RUS5); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF647 (TAIR:AT3G45890.1); Has 426 Blast hits to 424 proteins in 125 species: Archae - 0; Bacteria - 2; Metazoa - 111; Fungi - 69; Plants - 183; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
113	ath-MIR835	ath-miR835-3p	UGGAGAAGAUACGCAAGAAAG	ath-miR835-3p	AT1G19580.1	3	gamma carbonic anhydrase 1 (GAMMA CA1); FUNCTIONS IN: carbonate dehydratase activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, mitochondrial respiratory chain complex I, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004); BEST Arabidopsis thaliana protein match is: gamma carbonic anhydrase 2 (TAIR:AT1G47260.1); Has 10894 Blast hits to 10839 proteins in 2210 species: Archae - 265; Bacteria - 7962; Metazoa - 13; Fungi - 83; Plants - 197; Viruses - 0; Other Eukaryotes - 2374 (source: NCBI BLink).
113	ath-MIR835	ath-miR835-3p	UGGAGAAGAUACGCAAGAAAG	ath-miR835-3p	AT1G64150.1	3	Uncharacterized protein family (UPF0016); LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: Uncharacterized protein family (UPF0016) (TAIR:AT4G13590.1); Has 1632 Blast hits to 1475 proteins in 546 species: Archae - 26; Bacteria - 846; Metazoa - 163; Fungi - 173; Plants - 204; Viruses - 0; Other Eukaryotes - 220 (source: NCBI BLink).
114	ath-MIR837	ath-miR837-3p	AAACGAACAAAAAACUGAUGG	ath-miR837-3p	AT1G02410.1	3	cytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2749 Blast hits to 2749 proteins in 659 species: Archae - 0; Bacteria - 997; Metazoa - 98; Fungi - 130; Plants - 41; Viruses - 0; Other Eukaryotes - 1483 (source: NCBI BLink).
					AT1G79750.1	3	NADP-malic enzyme 4 (NADP-ME4); CONTAINS InterPro DOMAIN/s: Malic enzyme, NAD-binding (InterPro:IPR012302), Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding domain (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: NADP-malic enzyme 3 (TAIR:AT5G25880.1); Has 9573 Blast hits to 9553 proteins in 2441 species: Archae - 143; Bacteria - 6332; Metazoa - 610; Fungi - 220; Plants - 473; Viruses - 0; Other Eukaryotes - 1795 (source: NCBI BLink).
					AT3G06483.1	3	pyruvate dehydrogenase kinase (PDK); FUNCTIONS IN: ATP binding, pyruvate dehydrogenase (acetyl-transferring) kinase activity, histidine phosphotransfer kinase activity; INVOLVED IN: signal transduction, peptidyl-histidine phosphorylation, phosphorylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal transduction histidine kinase, core (InterPro:IPR005467), Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, mitochondrial (InterPro:IPR018955), ATPase-like, ATP-binding domain (InterPro:IPR003594), Signal transduction histidine kinase-related protein, C-terminal (InterPro:IPR004358); Has 1925 Blast hits to 1799 proteins in 531 species: Archae - 0; Bacteria - 712; Metazoa - 467; Fungi - 468; Plants - 102; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).
115	ath-MIR837	ath-miR837-5p	AUCAGUUUCUUGUUCGUUUCA	ath-miR837-5p	AT1G52590.1	3	Putative thiol-disulphide oxidoreductase DCC; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: Putative thiol-disulphide oxidoreductase DCC (TAIR:AT1G24095.1); Has 955 Blast hits to 955 proteins in 365 species: Archae - 5; Bacteria - 640; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 232 (source: NCBI BLink).
					AT2G04842.1	3	threonyl-tRNA synthetase, putative / threonine--tRNA ligase, putative; EMBRYO DEFECTIVE 2761 (EMB2761); FUNCTIONS IN: ligase activity, forming aminoacyl-tRNA and related compounds, nucleotide binding, aminoacyl-tRNA ligase activity, threonine-tRNA ligase activity, ATP binding; INVOLVED IN: threonyl-tRNA aminoacylation, embryo development ending in seed dormancy; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast; CONTAINS InterPro DOMAIN/s: Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (InterPro:IPR018163), Threonyl-tRNA synthetase, class IIa (InterPro:IPR002320), Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (InterPro:IPR002314), Aminoacyl-tRNA synthetase, class II, conserved domain (InterPro:IPR006195), Threonyl/alanyl tRNA synthetase, SAD (InterPro:IPR012947), Anticodon-binding (InterPro:IPR004154), Threonyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR018158); BEST Arabidopsis thaliana protein match is: Threonyl-tRNA synthetase (TAIR:AT5G26830.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
					AT2G32630.1	3	Pentatricopeptide repeat (PPR-like) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR-like) superfamily protein (TAIR:AT1G05670.2); Has 59391 Blast hits to 14965 proteins in 315 species: Archae - 4; Bacteria - 81; Metazoa - 864; Fungi - 1178; Plants - 55320; Viruses - 0; Other Eukaryotes - 1944 (source: NCBI BLink).
116	ath-MIR838	ath-miR838	UUUUCUUCUACUUCUUGCACA	ath-miR838	AT4G35440.1	3	chloride channel E (CLC-E); FUNCTIONS IN: ion channel activity, voltage-gated chloride channel activity; INVOLVED IN: chloride transport, transmembrane transport; LOCATED IN: chloroplast thylakoid membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloride channel, core (InterPro:IPR014743), Chloride channel, voltage gated (InterPro:IPR001807), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: chloride channel F (TAIR:AT1G55620.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
117	ath-MIR842	ath-miR842	UCAUGGUCAGAUCCGUCAUCC	ath-miR842	AT1G57570.1	1.5	Mannose-binding lectin superfamily protein; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: Mannose-binding lectin superfamily protein (TAIR:AT1G61230.1); Has 2072 Blast hits to 671 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 2064; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
117	ath-MIR842	ath-miR842	UCAUGGUCAGAUCCGUCAUCC	ath-miR842	AT1G62750.1	2	Translation elongation factor EFG/EF2 protein; SNOWY COTYLEDON 1 (SCO1); FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation elongation factor activity, ATP binding; INVOLVED IN: post-embryonic development, chloroplast organization, seed germination; LOCATED IN: mitochondrion, apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EFG/EF2, domain IV (InterPro:IPR005517), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), Translation elongation factor EFG/EF2 (InterPro:IPR004540), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), Ribosomal protein S5 domain 2-type fold, subgroup (InterPro:IPR014721), Elongation factor G/III/V (InterPro:IPR009022), Translation elongation/initiation factor/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: Translation elongation factor EFG/EF2 protein (TAIR:AT2G45030.1); Has 79823 Blast hits to 67706 proteins in 7071 species: Archae - 929; Bacteria - 47320; Metazoa - 4453; Fungi - 5428; Plants - 1613; Viruses - 3; Other Eukaryotes - 20077 (source: NCBI BLink).
118	ath-MIR843	ath-miR843	UUUAGGUCGAGCUUCAUUGGA	ath-miR843	AT1G11810.1	1.5	F-box associated ubiquitination effector family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT3G13830.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
					AT1G56520.1	3	Disease resistance protein (TIR-NBS-LRR class) family; FUNCTIONS IN: transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, apoptosis, defense response, innate immune response; LOCATED IN: intrinsic to membrane; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157), Disease resistance protein (InterPro:IPR000767); BEST Arabidopsis thaliana protein match is: Disease resistance protein (TIR-NBS-LRR class) (TAIR:AT1G56510.1); Has 16802 Blast hits to 12753 proteins in 523 species: Archae - 12; Bacteria - 1032; Metazoa - 1160; Fungi - 60; Plants - 14137; Viruses - 16; Other Eukaryotes - 385 (source: NCBI BLink).
					AT3G13830.1	0.5	F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box associated ubiquitination effector family protein (TAIR:AT1G11810.1); Has 1011 Blast hits to 960 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1011; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
119	ath-MIR844	ath-miR844-3p	UUAUAAGCCAUCUUACUAGUU	ath-miR844-3p	AT3G46540.1	3	ENTH/VHS family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epsin, N-terminal (InterPro:IPR001026), Epsin-like, N-terminal (InterPro:IPR013809), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: ENTH/VHS family protein (TAIR:AT1G08670.1); Has 992 Blast hits to 992 proteins in 193 species: Archae - 0; Bacteria - 0; Metazoa - 538; Fungi - 205; Plants - 176; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
120	ath-MIR846	ath-miR846	UUGAAUUGAAGUGCUUGAAUU	ath-miR846	AT1G57570.1	1	Mannose-binding lectin superfamily protein; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: Mannose-binding lectin superfamily protein (TAIR:AT1G61230.1); Has 2072 Blast hits to 671 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 2064; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
121	ath-MIR851	ath-miR851-3p	UGGGUGGCAAACAAAGACGAC	ath-miR851-3p	AT1G01080.1	3	RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, nucleus, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1); Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819; Bacteria - 303967; Metazoa - 99035; Fungi - 14863; Plants - 31737; Viruses - 35534; Other Eukaryotes - 13112 (source: NCBI BLink).
121	ath-MIR851	ath-miR851-3p	UGGGUGGCAAACAAAGACGAC	ath-miR851-3p	AT1G01080.2	3	RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
122	ath-MIR851	ath-miR851-5p	UCUCGGUUCGCGAUCCACAAG	ath-miR851-5p	AT1G67630.1	3	DNA polymerase alpha 2 (POLA2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha, subunit B N-terminal (InterPro:IPR013627), DNA polymerase alpha, subunit B (InterPro:IPR016722), DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 415 Blast hits to 412 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 175; Fungi - 140; Plants - 46; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
123	ath-MIR854a	ath-miR854a	GAUGAGGAUAGGGAGGAGGAG	ath-miR854a	AT1G49290.1	2	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13620.1); Has 99 Blast hits to 93 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
123	ath-MIR854a	ath-miR854a	GAUGAGGAUAGGGAGGAGGAG	ath-miR854a	AT4G01110.1	2.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01453.1); Has 273 Blast hits to 272 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 273; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
124	ath-MIR854b	ath-miR854b	GAUGAGGAUAGGGAGGAGGAG	ath-miR854b	AT1G49290.1	2	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13620.1); Has 99 Blast hits to 93 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
124	ath-MIR854b	ath-miR854b	GAUGAGGAUAGGGAGGAGGAG	ath-miR854b	AT4G01110.1	2.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01453.1); Has 273 Blast hits to 272 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 273; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
125	ath-MIR854c	ath-miR854c	GAUGAGGAUAGGGAGGAGGAG	ath-miR854c	AT1G49290.1	2	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13620.1); Has 99 Blast hits to 93 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
125	ath-MIR854c	ath-miR854c	GAUGAGGAUAGGGAGGAGGAG	ath-miR854c	AT4G01110.1	2.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01453.1); Has 273 Blast hits to 272 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 273; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
126	ath-MIR854d	ath-miR854d	GAUGAGGAUAGGGAGGAGGAG	ath-miR854d	AT1G49290.1	2	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13620.1); Has 99 Blast hits to 93 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
126	ath-MIR854d	ath-miR854d	GAUGAGGAUAGGGAGGAGGAG	ath-miR854d	AT4G01110.1	2.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01453.1); Has 273 Blast hits to 272 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 273; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
127	ath-MIR854e	ath-miR854e	GAUGAGGAUAGGGAGGAGGAG	ath-miR854e	AT1G49290.1	2	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13620.1); Has 99 Blast hits to 93 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
127	ath-MIR854e	ath-miR854e	GAUGAGGAUAGGGAGGAGGAG	ath-miR854e	AT4G01110.1	2.5	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01453.1); Has 273 Blast hits to 272 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 273; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
128	ath-MIR855	ath-miR855	AGCAAAAGCUAAGGAAAAGGAA	ath-miR855	AT5G57300.1	3	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT1G23360.1); Has 8727 Blast hits to 8715 proteins in 2245 species: Archae - 103; Bacteria - 5342; Metazoa - 137; Fungi - 134; Plants - 200; Viruses - 0; Other Eukaryotes - 2811 (source: NCBI BLink).
128	ath-MIR855	ath-miR855	AGCAAAAGCUAAGGAAAAGGAA	ath-miR855	AT5G57300.2	3	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT1G23360.1); Has 8727 Blast hits to 8715 proteins in 2245 species: Archae - 103; Bacteria - 5342; Metazoa - 137; Fungi - 134; Plants - 200; Viruses - 0; Other Eukaryotes - 2811 (source: NCBI BLink).
129	ath-MIR857	ath-miR857	UUUUGUAUGUUGAAGGUGUAU	ath-miR857	AT1G50820.1	1.5	Aminotransferase-like, plant mobile domain family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Aminotransferase-like, plant mobile domain (InterPro:IPR019557); BEST Arabidopsis thaliana protein match is: Plant mobile domain protein family (TAIR:AT1G50790.1); Has 564 Blast hits to 557 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 564; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
129	ath-MIR857	ath-miR857	UUUUGUAUGUUGAAGGUGUAU	ath-miR857	AT4G32810.1	3	carotenoid cleavage dioxygenase 8 (CCD8); CONTAINS InterPro DOMAIN/s: Carotenoid oxygenase (InterPro:IPR004294); BEST Arabidopsis thaliana protein match is: nine-cis-epoxycarotenoid dioxygenase 6 (TAIR:AT3G24220.1); Has 2642 Blast hits to 2570 proteins in 479 species: Archae - 17; Bacteria - 769; Metazoa - 368; Fungi - 139; Plants - 827; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink).
130	ath-MIR859	ath-miR859	UCUCUCUGUUGUGAAGUCAAA	ath-miR859	AT3G13830.1	2	F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box associated ubiquitination effector family protein (TAIR:AT1G11810.1); Has 1011 Blast hits to 960 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1011; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
131	ath-MIR861	ath-miR861-3p	GAUGGAUAUGUCUUCAAGGAC	ath-miR861-3p	AT1G07900.1	3	LOB domain-containing protein 1 (LBD1); CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: LOB domain-containing protein 11 (TAIR:AT2G28500.1); Has 1035 Blast hits to 1030 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1035; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
					AT1G24793.1	3	UDP-3-O-acyl N-acetylglycosamine deacetylase family protein; FUNCTIONS IN: UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase activity; INVOLVED IN: lipid A biosynthetic process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: UDP-3-O-acyl N-acetylglucosamine deacetylase, N-terminal (InterPro:IPR015870), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), UDP-3-O-acyl N-acetylglucosamine deacetylase (InterPro:IPR004463), UDP-3-O-acyl N-acetylglucosamine deacetylase, C-terminal (InterPro:IPR011334); BEST Arabidopsis thaliana protein match is: UDP-3-O-acyl N-acetylglycosamine deacetylase family protein (TAIR:AT1G24880.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
					AT1G24880.1	3	UDP-3-O-acyl N-acetylglycosamine deacetylase family protein; FUNCTIONS IN: UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase activity; INVOLVED IN: lipid A biosynthetic process; CONTAINS InterPro DOMAIN/s: UDP-3-O-acyl N-acetylglucosamine deacetylase, N-terminal (InterPro:IPR015870), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), UDP-3-O-acyl N-acetylglucosamine deacetylase (InterPro:IPR004463), UDP-3-O-acyl N-acetylglucosamine deacetylase, C-terminal (InterPro:IPR011334); BEST Arabidopsis thaliana protein match is: UDP-3-O-acyl N-acetylglycosamine deacetylase family protein (TAIR:AT1G25054.1); Has 5321 Blast hits to 5321 proteins in 1417 species: Archae - 0; Bacteria - 2995; Metazoa - 1; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink).
					AT1G25054.1	3	UDP-3-O-acyl N-acetylglycosamine deacetylase family protein; FUNCTIONS IN: UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase activity; INVOLVED IN: lipid A biosynthetic process; CONTAINS InterPro DOMAIN/s: UDP-3-O-acyl N-acetylglucosamine deacetylase, N-terminal (InterPro:IPR015870), UDP-3-O-acyl N-acetylglucosamine deacetylase (InterPro:IPR004463), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), UDP-3-O-acyl N-acetylglucosamine deacetylase, C-terminal (InterPro:IPR011334); BEST Arabidopsis thaliana protein match is: UDP-3-O-acyl N-acetylglycosamine deacetylase family protein (TAIR:AT1G24880.1); Has 5320 Blast hits to 5320 proteins in 1417 species: Archae - 0; Bacteria - 2992; Metazoa - 1; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink).
					AT1G25210.1	3	UDP-3-O-acyl N-acetylglycosamine deacetylase family protein; FUNCTIONS IN: UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase activity; INVOLVED IN: lipid A biosynthetic process; CONTAINS InterPro DOMAIN/s: UDP-3-O-acyl N-acetylglucosamine deacetylase, N-terminal (InterPro:IPR015870), UDP-3-O-acyl N-acetylglucosamine deacetylase (InterPro:IPR004463), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), UDP-3-O-acyl N-acetylglucosamine deacetylase, C-terminal (InterPro:IPR011334); BEST Arabidopsis thaliana protein match is: UDP-3-O-acyl N-acetylglycosamine deacetylase family protein (TAIR:AT1G24880.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
132	ath-MIR862	ath-miR862-5p	UCCAAUAGGUCGAGCAUGUGC	ath-miR862-5p	AT1G18870.1	3	isochorismate synthase 2 (ICS2); CONTAINS InterPro DOMAIN/s: Chorismate binding, C-terminal (InterPro:IPR015890), ADC synthase (InterPro:IPR005801), Isochorismate synthase (InterPro:IPR004561); BEST Arabidopsis thaliana protein match is: ADC synthase superfamily protein (TAIR:AT1G74710.1); Has 14372 Blast hits to 14368 proteins in 2522 species: Archae - 246; Bacteria - 10572; Metazoa - 5; Fungi - 239; Plants - 212; Viruses - 0; Other Eukaryotes - 3098 (source: NCBI BLink).
133	ath-MIR863	ath-miR863-3p	UUGAGAGCAACAAGACAUAAU	ath-miR863-3p	AT1G01240.3	3	unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).
134	ath-MIR863	ath-miR863-5p	UUAUGUCUUGUUGAUCUCAAU	ath-miR863-5p	AT5G28810.1	2	CONTAINS InterPro DOMAIN/s: Domain of unknown function DUF1985 (InterPro:IPR015410); BEST Arabidopsis thaliana protein match is: Ulp1 protease family protein (TAIR:AT5G45570.1); Has 439 Blast hits to 418 proteins in 91 species: Archae - 2; Bacteria - 72; Metazoa - 105; Fungi - 15; Plants - 124; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
135	ath-MIR865	ath-miR865-3p	UUUUUCCUCAAAUUUAUCCAA	ath-miR865-3p	AT1G63250.1	3	DEA(D/H)-box RNA helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEA(D/H)-box RNA helicase family protein (TAIR:AT2G07750.1); Has 39480 Blast hits to 38845 proteins in 2963 species: Archae - 566; Bacteria - 19506; Metazoa - 5817; Fungi - 4606; Plants - 2531; Viruses - 8; Other Eukaryotes - 6446 (source: NCBI BLink).
					AT3G09050.1	3	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 47 species: Archae - 4; Bacteria - 10; Metazoa - 33; Fungi - 2; Plants - 44; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
					AT3G10160.1	2.5	tetrahydrofolylpolyglutamate synthase activitył DHFS-FPGS homolog C (DFC); CONTAINS InterPro DOMAIN/s: Mur ligase, central (InterPro:IPR013221), Folylpolyglutamate synthetase, conserved site (InterPro:IPR018109), Mur ligase, C-terminal (InterPro:IPR004101), Folylpolyglutamate synthetase (InterPro:IPR001645); BEST Arabidopsis thaliana protein match is: DHFS-FPGS homolog B (TAIR:AT5G05980.2); Has 7721 Blast hits to 7719 proteins in 2542 species: Archae - 43; Bacteria - 4847; Metazoa - 165; Fungi - 368; Plants - 133; Viruses - 0; Other Eukaryotes - 2165 (source: NCBI BLink).
136	ath-MIR866	ath-miR866-3p	ACAAAAUCCGUCUUUGAAGA	ath-miR866-3p	AT2G22070.1	2.5	pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G25360.1); Has 47939 Blast hits to 14346 proteins in 287 species: Archae - 0; Bacteria - 20; Metazoa - 98; Fungi - 122; Plants - 46979; Viruses - 0; Other Eukaryotes - 720 (source: NCBI BLink).
137	ath-MIR866	ath-miR866-5p	UCAAGGAACGGAUUUUGUUAA	ath-miR866-5p	AT4G21700.1	2.5	Protein of unknown function (DUF2921); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2921 (InterPro:IPR021319); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF2921) (TAIR:AT1G52780.1); Has 127 Blast hits to 111 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
138	ath-MIR868	ath-miR868	CUUCUUAAGUGCUGAUAAUGC	ath-miR868	AT1G16720.1	3	high chlorophyll fluorescence phenotype 173 (HCF173); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: photosystem II assembly, translational initiation; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding domain (InterPro:IPR016040), NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT4G18810.2); Has 1950 Blast hits to 1792 proteins in 453 species: Archae - 27; Bacteria - 1263; Metazoa - 9; Fungi - 6; Plants - 464; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink).
139	ath-MIR869	ath-miR869.1	AUUGGUUCAAUUCUGGUGUUG	ath-miR869.1	AT2G44620.1	3	mitochondrial acyl carrier protein 1 (MTACP-1); FUNCTIONS IN: phosphopantetheine binding, acyl carrier activity, cofactor binding; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphopantetheine-binding (InterPro:IPR006163), Acyl carrier protein (ACP) (InterPro:IPR003231), Acyl carrier protein-like (InterPro:IPR009081), Phosphopantetheine attachment site (InterPro:IPR006162); BEST Arabidopsis thaliana protein match is: mitochondrial acyl carrier protein 2 (TAIR:AT1G65290.1); Has 7851 Blast hits to 7848 proteins in 2525 species: Archae - 0; Bacteria - 5315; Metazoa - 204; Fungi - 139; Plants - 352; Viruses - 2; Other Eukaryotes - 1839 (source: NCBI BLink).
140	ath-MIR869	ath-miR869.2	UCUGGUGUUGAGAUAGUUGAC	ath-miR869.1	AT1G67120.1	3	ATPases;nucleotide binding;ATP binding;nucleoside-triphosphatases;transcription factor binding; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, transcription factor binding, nucleotide binding, ATP binding; INVOLVED IN: regulation of transcription, DNA-dependent, regulation of protein complex assembly; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Midasin (InterPro:IPR012099), ATPase, AAA-5 (InterPro:IPR011704), ATPase, AAA+ type, core (InterPro:IPR003593), von Willebrand factor, type A (InterPro:IPR002035), RNA polymerase sigma factor 54, interaction (InterPro:IPR002078); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).
141	ath-MIR870	ath-miR870	UAAUUUGGUGUUUCUUCGAUC	ath-miR870	AT4G02530.1	3	chloroplast thylakoid lumen protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 54 Blast hits to 54 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

Sheet 3: Suppl Tab2b

Supplementary Table 2b. List of the experimentally confirmed Arabidopsis miRNAs with the validated organellar targets (from miRTarBase).

miRTarBase ID

miRNA

Target Gene

Target AGI

Target Entrez ID

Experiments

Support Type

References

MIRT002095

miR398a-3p

CSD2 (copper/zinc superoxide dismutase 2)

AT2G28190

817365

Western blot

Functional MTI

Dugas & Bartel, 2008; Addo-Quaye et al., 2008

Microarray//qRT-PCR//Western blot

Functional MTI

5"RACE//Northern blot

Functional MTI (Weak)

MIRT005464

miR398a-3p

CCS (copper chaperone for SOD1)

AT1G12520

837808

5"RACE//Northern blot

Functional MTI (Weak)

Bouche, 2010

MIRT002092

miR398b-3p

CSD2 (copper/zinc superoxide dismutase 2)

AT2G28190

817365

Western blot

Functional MTI

Dugas & Bartel, 2008; Addo-Quaye et al., 2008

5"RACE//Northern blot

Functional MTI (Weak)

MIRT005465

miR398b-3p

CCS (copper chaperone for SOD1)

AT1G12520

837808

5"RACE//Northern blot

Functional MTI (Weak)

Bouche, 2010

MIRT002091

miR398c-3p

CSD2 (copper/zinc superoxide dismutase 2)

AT2G28190

817365

Western blot

Functional MTI

Dugas & Bartel, 2008; Addo-Quaye et al., 2008

5"RACE//Northern blot

Functional MTI (Weak)

MIRT005466

miR398c-3p

CCS (copper chaperone for SOD1)

AT1G12520

837808

5"RACE//Northern blot

Functional MTI (Weak)

Bouche, 2010

MIRT007401

miR400

Pentatricopeptide repeat (PPR) superfamily protein

AT1G06580

837169

Degradome

Functional MTI (Weak)

Addo-Quaye et al., 2008; German et al., 2008

MIRT007398

miR400

Pentatricopeptide repeat (PPR) superfamily protein

AT1G62720

842570

Degradome

Functional MTI (Weak)

German et al., 2008

MIRT007400

miR400

Tetratricopeptide repeat (TPR)-like superfamily protein

AT1G62930

842594

Degradome

Functional MTI (Weak)

MIRT007399

miR400

Pentatricopeptide repeat (PPR) superfamily protein

AT1G64580

842766

Degradome

Functional MTI (Weak)

MIRT005798

miR408-3p

Peptide chain release factor 1

AT2G47020

819316

qRT-PCR

Functional MTI (Weak)

Zhang et al., 2011

MIRT007391

miR837-3p

Lipoyl synthase

AT5G08415

830740

Degradome

Functional MTI (Weak)

Addo-Quaye et al., 2008

MIRT005803

miR1888a

Tetratricopeptide repeat (TPR)-like superfamily protein)

AT5G08310

830727

qRT-PCR

Non-Functional MTI (Weak)

Zhang et al., 2011

messengers for plastid proteins

messengers for mitochondrial proteins

Protein subcellular localisation was verified by SUBA3 [Tanz SK, Castleden I, Hooper CM, Vacher M, Small I, Millar AH (2013) SUBA3: a database for integrating experimentation and prediction to define the SUBcellular location of proteins in Arabidopsis. Nucl Acids Res 41: D1185-D1191. http://dx.doi.org/10.1093/nar/gks1151]