Acta Biochimica Polonica, Vol. 65, No 1/2018, 51–57, https://doi.org/10.18388/abp.2016_1425
Regular paper
The ESR1 and GPX1 gene expression level in human malignant and non-malignant breast tissues
1Department of Biological and Environmental Monitoring, Nofer Institute of Occupational Medicine, Łódź, Poland; 2Department of Surgical Oncology, Copernicus Memorial Hospital, Cancer Center, Łódź, Poland; 3Department of Toxicology and Carcinogenesis, Nofer Institute of Occupational Medicine, Łódź, Poland
Background: The aim of this study was to establish whether the gene expression of estrogen receptor alpha (encoded by ESR1) correlates with the expression of glutathione peroxidase 1 (encoded by GPX1) in the tumor and adjacent tumor-free breast tissue, and whether this correlation is affected by breast cancer. Such relationships may give further insights into breast cancer pathology with respect to the status of estrogen receptor. Methods: We used the quantitative real-time PCR technique to analyze differences in the expression levels of the ESR1 and GPX1 genes in paired malignant and non-malignant tissues from breast cancer patients. Results: ESR1 and GPX1 expression levels were found to be significantly down-regulated by 14.7% and 7.4% (respectively) in the tumorous breast tissue when compared to the non-malignant one. Down-regulation of these genes was independent of the tumor histopathology classification and clinicopathological factors, while the ESR1 mRNA level was reduced with increasing tumor grade (G1: 103% vs. G2: 85.8% vs. G3: 84.5%; p<0.05). In the non-malignant and malignant breast tissues, the expression levels of ESR1 and GPX1 were significantly correlated with each other (Rs=0.450 and Rs=0.360; respectively). Conclusion: Our data suggest that down-regulation of ESR1 and GPX1 was independent of clinicopathological factors. Down-regulation of ESR1 gene expression was enhanced by the development of the disease. Moreover, GPX1 and ESR1 gene expression was interdependent in the malignant breast tissue and further work is needed to determine the mechanism underlying this relationship.
Key words: estrogen receptor, antioxidant enzymes, gene expression, breast cancer tissue
Received: 13 September, 2016; revised: 11 July, 2017; accepted:
05 March, 2018; available on-line: 15 March, 2018
*e-mail: lenakrol@imp.lodz.pl
Abbreviations: ERs, estrogen receptors; ERα and ERβ, alpha and beta estrogen receptors; GPx’s, glutathione peroxidases; ROS, reactive oxygen species; Trx, thioredoxin; TrxRs, thioredoxin reductases
Introduction
Breast cancer is the most common cancer among women worldwide. The number of diagnosed breast cancer cases among women has continued to rise since the 1980’s, and now it constitutes 20% of all malignant tumors. Women aged 45–69 years are at the highest risk of developing breast cancer, and the incidence rate in that group is 50% of all the diagnosed breast cancer cases (Bojar et al., 2012).
Pathogenesis and development of breast cancer is often related to estrogen receptors (ERs) and their estrogen ligands. ERs belong to a large family of nuclear receptors that play a role of a transcription factors in cells. There are two types of ERs: alpha (ERα) and beta (ERβ) encoded by the ESR1 and ESR2 genes, respectively, and presenting opposite roles. Activation of ERα is associated with proliferation and growth of tumor cells (Au et al., 2007; Lin et al., 2007), while ERβ promotes apoptosis, suppresses malignant transformation and inhibits growth of tumor cells (Ström et al., 2004; Paruthiyil et al., 2004; Behrens et al., 2007). ERs regulate transcription by direct interaction and binding to DNA (Klinge, 2001) or indirectly through other transcription factors (e.g. AP-1 activator protein-1) (Kushner et al., 2000). ERs owe the ability to bind to DNA to specific zinc finger structures located in their DNA-binding domain. One zinc finger is responsible for binding to DNA, while the function of the other one is to stabilize the ER–ER homodimer (Schwabe et al., 1993). Zinc fingers are highly susceptible to oxidation, which for example may occur due to accumulation of reactive oxygen species (ROS) (Webster et al., 2001). Oxidation of cysteine thiol groups results in the release of zinc ions, causing change in the tertiary structure and loss of the protein ability to bind to DNA (Liang et al., 1998).
Cells are protected from oxidizing agents, such as ROS, by antioxidant enzymes: catalase, superoxide dismutases (soluble and extracellular Cu/ZnSOD and MnSOD) and selenoproteins, such as the family of glutathione peroxidases (GPx’s) and thioredoxin reductases (TrxRs) which, with glutathione and thioredoxin (Trx), respectively, form an active ROS-reduction system and ensure redox homeostasis in a cell (Schafer & Buettner, 2001; Valko et al., 2007). Cu/ZnSOD is the first line of defense against ROS by catalyzing the dismutation reaction of the superoxide anion radical to hydrogen peroxide. TrxR, on the other hand, utilizes NADPH to reduce and activate Trx, as well as other proteins (Mustacich & Powis, 2000). Reduced Trx is an oxidative stress response protein that activates transcription factors in order to alter the expression of peroxiredoxin genes, so that cellular hydrogen peroxide can be diminished (Webster et al., 2001). H2O2 is also subsequently enzymatically reduced to water by peroxidases, including GPx-1 (encoded by GPX1) and catalase. GPx-1 is found in the cytosol, in mitochondria, and also in peroxisomes. It uses reducing equivalents of glutathione to detoxify organic and hydrogen peroxides, and its activity depends on the selenium availability (Lubos et al., 2011). It was previously reported by Shultz-Norton (2008) that TrxR and Cu/ZnSOD are closely related to ERα by being a part of a large ERα-ERE (estrogen response element) protein complex in the nucleus, where they influence regulation of estrogen-responsive genes in the target cell (Rao et al., 2009; Rao et al., 2008). Apart from this, TrxR is involved in maintaining a reduced cellular environment and active transcription factors (Arnér & Holmgren, 2000). That observation provides evidence of its special function in protecting ERα against oxidative agents in the nucleus.
Due to strong antioxidant properties of GPx-1 and high sensitivity of zinc finger structures to ROS, and the presence of Cu/ZnSOD and TrxR in the nucleus protein complex, we decided to investigate the relationship between the GPX1 mRNA level and the ESR1 mRNA level in human breast tissue.
More specifically, the differences in constitutive expression levels of the above mentioned genes between the healthy non-malignant and paired tumorous breast tissue specimens, as well as their mutual associations in the healthy and/or tumorous breast tissues, were analyzed. Moreover, the effect of tumor grading and staging on the above mentioned differences and/or associations was determined. The investigated relationships between the expression levels of the targeted genes may give further insights into breast cancer pathology with respect to the estrogen receptor status.
Materials and methods
Patients and tissue specimens The study involved 37 breast cancer female patients aged 44–82 years (mean age 63.1 years; S.D. 9.9 years) undergoing a curative resection surgery without adjuvant chemotherapy or radiotherapy at the Department of Oncology Surgery, Regional Cancer Center in Lodz, Poland, between November 2011 and December 2013.
Of all the enrolled patients, 9 reported themselves as current-smokers, 9 as ex-smokers, 18 as non-smokers and 1 subject did not specify her smoking-status in detail. At the time of the study, none of the subjects received hormonal replacement therapy, but 9 of them declared hormonal treatment for more than 1 year in the past. Detailed characteristics of the investigated group of patients with respect to various clinicopathological factors (the histological grade (G), the primary tumor site (T) and the regional lymph node involvement (N), estrogen receptor (ER) and progesterone receptor (PR) status, Her/neu-2 status) and their smoking status, are presented in Table 1. There were no statistically significant differences in the age and BMI between the above mentioned groups (data not shown).
Table 1. Normalized expression of ESR1 and GPX1 genes in tumorous breast tissue when compared to the paired non–malignant breast tissue. Results of expression analysis stratified by various clinicopathological features of tumors and between–group comparisons.
|
N |
NRQ |
|||
|
ESR1 |
GPX1 |
|||
|
All patientsa |
37 |
0.872 (0.691–1.154)* |
0.931 (0.753–1.080)* |
|
|
Histopathological classificationa |
||||
|
Ductal carcinoma |
24 |
0.921 (0.711–1.172)* |
0.947 (0.759–1.149)* |
|
|
Non-ductal carcinoma |
13 |
0.861 (0.699–1.091)* |
0.860 (0.753–0.980)* |
|
|
Estrogen receptor statusa |
||||
|
ER– |
8 |
0.801 (0.732–0.913) |
0.889 (0.809–0.933)* |
|
|
ER+ |
29 |
0.934 (0.793–1.000)* |
0.897 (0.833–0.982)* |
|
|
Progesterone receptor statusa |
||||
|
PR– |
14 |
0.793 (0.739–0.925)* |
0.901 (0.859–0.943)* |
|
|
PR+ |
23 |
0.944 (0.814–1.029) |
0.893 (0.832–0.984)* |
|
|
Her/neu-2 statusa |
||||
|
HER2– |
34 |
0.875 (0.739–0.989)* |
0.901 (0.835–0.978)* |
|
|
HER2+ |
3 |
0.938 (0.766–0.945) |
0.866 (0.639–0.972) |
|
|
Histological gradeb |
||||
|
G1 |
6 |
1.038 (0.944–1.063) |
0.973 (0.898–1.008) |
|
|
G2 |
19 |
0.858 (0.747–0.966) |
0.893 (0.841–0.972) |
|
|
G3 |
12 |
0.845 (0.710–0.959) |
0.907 (0.819–0.942) |
|
|
Tumor sizea |
||||
|
T1 |
18 |
0.901 (0.717–1.148) |
0.777 (0.547–1.060) |
|
|
T2 |
18 |
0.907 (0.693–1.140)* |
0.895 (0.767–1.040)* |
|
|
Lymph node involvementa |
||||
|
N0 |
23 |
0.890 (0.721–1.105)* |
0.875 (0.751–1.040)* |
|
|
N1 |
12 |
0.915 (0.673–1.228) |
0.756 (0.575–1.000) |
|
|
Data presented as median normalized relative quantity (NRQ) of mRNA copies in paired tissue samples with respective interquartile range (in parentheses). In stratified analysis, NRQ values (i.e. ratio of normalized expression of a gene in tumorous breast tissue to paired non–malignant breast tissue) within all strata were tested for significance by means of the Mann–Whitney U test. Statistically significant NRQs are indicated by asterisks (*p<0.05); Between–group comparisons of ESR1 and GPX1 expression levels were tested for significances by athe Mann–Whitney U test or bKruskal–Wallis test. Statistically significant differences between individual strata are presented in bold (p<0.05). |
||||
Prior to analysis, a written and informed consent for participation in the study was obtained from each enrolled subject. The study was performed in accordance with the guidelines of the Helsinki Declaration for human research and was approved by the Local Bioethics Committee for Scientific Research (resolution no. 01/2011).
Thirty-seven primary breast tumor specimens (including 25 ductal carcinomas and 12 breast tumors of different types: 5 lobular carcinomas and 7 not specific type carcinomas) with paired non-malignant surrounding breast tissue samples, were removed intra-operationally and placed immediately at –20°C for 24 h, transported to the Nofer Institute of Occupational Medicine and stored at –80°C until further processing.
Gene expression analysis. Total RNA was isolated from the malignant and adjacent non-malignant breast tissue specimens using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction. Genomic DNA contamination was removed by the on-column digestion with the RNase-free DNase set (Qiagen, Hilden, Germany). Total RNA was further quantified and analyzed with regard to protein content using an Eppendorf BioPhotometer instrument (Eppendorf, Germany) and stored at –80°C. An aliquot of 200 ng of purified RNA was then reverse-transcribed in a 20 μl reaction mixture using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, on an MJ Research BioRad PTC-200 DNA Peltier thermal cycler (MJ Research, Watertown, MA, USA) and the cDNA samples were frozen at –20°C.
Expression levels of the ESR1 and GPX1 genes were evaluated by means of the quantitative real-time PCR (qPCR) technique with the BioRad’s CFX96 Real Time PCR system (BioRad, Hercules, CA, USA) using an SsoAdvanced SYBR Green Supermix (BioRad, Hercules, CA, USA) and beta-actin (ACTB) as the reference gene. Real-time PCR reactions were performed in 10 μl reaction mixture containing 5 ng cDNA, 500 nM of each of the forward and reverse primers, and 1x SsoAdvanced SYBR Green Supermix. The primer sequences (Table 2) were designed by the Beacon Designer 7.0 (PREMIER Biosoft Int., Palo Alto, CA, USA) and cycling conditions comprised of 30 s of polymerase activation at 95°C, followed by 49 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s and extension at 72°C for 30 s. Products of the PCR reaction were analyzed by means of the Melt Curve technique using the Bio-Rad CFX Manager Software. qPCR efficiencies were calculated using dilutions of 5 randomly selected and pooled cDNA samples. All of the samples were measured in duplicate and the paired malignant and non-malignant breast tissue specimens were always analyzed in one analytical run in order to avoid between-run variations. As confirmed by the initial data analysis, expression of the reference gene (ACTB) was stable under experimental conditions.
Table 2. List of the primer sequences used in the real-time PCR assays.
|
Gene |
Gene name |
Forward primer (5’-3’) |
Reverse primer (5’-3’) |
Amplicon length (bp) |
|
ESR1 |
estrogen receptor alpha |
aggctttgtggatttgac |
ccaagagcaagttaggag |
137 |
|
GPX1 |
glutathione peroxidase 1 |
caaccagtttgggcatcag |
tctcgaagagcatgaagttgg |
107 |
|
ACTB |
beta-actin |
ccaaccgcgagaagatgacc |
ggagtccatcacgatgccag |
125 |
Normalized relative expression level (NRQ) for a given gene of interest in the tumorous versus the paired adjacent non-malignant sample and the expression level of genes of interest normalized to the expression level of the housekeeping gene ACTB (NQ) was calculated utilizing a method described previously by Pfaffl (Pfaffl et al., 2002), based on each sample’s average CT value and each gene’s average PCR efficiency.
Statistical analysis Normality of the data was evaluated by the Shapiro-Wilk’s W-test. Experimental data showing departure from normality are presented as median and interquartile range (IQR; in parentheses). To test whether differences in the expression levels of genes of interest normalized to the expression levels of the reference gene between the non-malignant and tumorous breast tissues met the criterion of statistical significance, the Mann-Whitney U-test was utilized. The between-group differences in the measured parameters were tested by the Mann-Whitney U test or the Kruskal-Wallis test. Spearman’s rank correlation coefficient (RS) was used to assess simple associations between the variables. Analyses were performed using the STATISTICA 10 software package (StatSoft, Tulsa, OK, USA).
Results
Expression level of ESR1and GPX1 genes in malignant and non-malignant breast tissues
We observed a statistically significant down-regulation of expression level of the ESR1 and GPX1 genes in tumorous breast tissue when compared to the adjacent non-malignant one. In the tumorous tissue samples, expression level of the ESR1 gene was down-regulated when compared to the adjacent non-malignant one by 14.7% (NRQ(ESR1)=0.872, IQR: 0.691-1.154; p<0.05), whereas the expression level of GPX1 was reduced by 7.4 % (NRQ(GPX1)=0.931, IQR: 0.753-1.080; p<0.05) (Table 1).
Expression level of the ESR1 and GPX1 genes in malignant and non-malignant breast tissue according to clinicopathological characteristics
We observed statistically significant differences in down-regulation of expression level of the ESR1 gene between the group of patients with negative and positive progesterone receptor status (PR-:NRQ(ESR1)=0.793, IQR:0.739–0.925 vs. PR+:NRQ(ESR1)=0.944, IQR:0.814–1.029; p<0.05). The expression level of ESR1 also depended on the tumor grade classification (G). We observed a statistically significant decline in ESR1 mRNA level with an increasing tumor grade (G1:NRQ(ESR1)=1.038, IQR:0.944–1.063 vs. G2:NRQ(ESR1)=0.858, IQR:0.747–0.966 vs. G3:NRQ(ESR1)=0.845, IQR:0.710–0.959; p<0.05). We did not observe any statistically significant differences in down-regulation of expression level of GPX1 or ESR1 between the groups with various histopathological type of tumor, estrogen receptor status, Her/neu-2 status, tumor size or lymph node involvement (Table 1).
Stratified analysis Analysis of the experimental data revealed a statistically significant down-regulation of ESR1 gene expression in the malignant breast tissue when compared to its non-malignant counterpart, regardless of the histopathological classification of breast cancer (NRQ(ESR1)=0.861, IQR:0.699–1.091; p<0.05 for non-ductal type and NRQ(ESR1)=0.921, IQR:0.711–1.172; p<0.05 for ductal carcinoma), as well as in the group of patients without lymph node metastases (N0) (NRQ(ESR1)=0.890, IQR:0.721–1.105; p<0.05), and larger tumor size (T2) (NRQ(ESR1)=0.907, IQR:0.693–1.140; p<0.05). Furthermore, decreased expression of ESR1 in tumorous breast tissue when compared to the adjacent non-malignant breast tissue was observed in the group of patients with positive estrogen receptor status (NRQ(ESR1)=0.934, IQR:0.793–1.000; p<0.05), negative progesterone receptor status (NRQ(ESR1)=0.793, IQR:0.739–0.925; p<0.05) and negative Her/neu-2 status (NRQ(ESR1)=0.875, IQR:0.739–0.989; p<0.05).
Regarding the GPX1 expression level in the malignant breast tissue when compared to its non-malignant counterpart, we observed a significant down-regulation of this gene’s expression among patients with ductal carcinoma (NRQ(GPX1)=0.947, IQR:0.759–1.149; p<0.05) and non-ductal carcinoma (NRQ(GPX1)=0.860, IQR:0.753–0.980; p<0.05), as well as in the group of patients without lymph node metastases (N0) (NRQ(GPX1)=0.875, IQR:0.751–1.040; p<0.05) and larger tumor size (T2) (NRQ(GPX1)=0.895, IQR:0.767–1.040; p<0.05). Furthermore, a decreased expression of GPX1 in tumorous breast tissue when compared to the adjacent non-malignant breast tissue was observed in the group of patients with positive and negative estrogen receptor status (ER+: NRQ(GPX1)=0.897, IQR:0.833–0.982 and ER–: NRQ(GPX1)=0.889, IQR:0.809–0.933; p<0.05), positive and negative progesterone receptor status (PR+: NRQ(GPX1)=0.893, IQR:0.832–0.984 and PR–: NRQ(GPX1)=0.901, IQR:0.859–0.943; p<0.05) and negative Her/neu-2 status (NRQ(GPX1)=0.901, IQR:0.835–0.978; p<0.05).
Down-regulation of ESR1 and GPX1 expression in the malignant breast tissue as compared to its non-malignant counterpart also concerns the non- and ex-smoker groups of patients (NRQ(ESR1)=0.902, IQR:0.700–1.174 and NRQ(GPX1)=0.919, IQR:0.741–1.112; p<0.05), and the current smoker group in the case of GPX1 expression only (NRQ(GPX1)=0.924, IQR:0.821–1.045; p<0.05) (Table 1).
Correlation between the expression levels of the investigated genes in the malignant and non-malignant breast tissue samples
We found significant positive correlations between normalized relative expression levels (NRQ) of ESR1 and GPX1 (RS=0.454, p<0.05) (Fig. 1), as well as the normalized expression level (NQ) of these genes in both, the non-malignant (RS=0.450, p<0.05) (Fig. 2) and malignant (RS=0.360, p<0.05) (Fig. 3), breast tissue samples analyzed separately. We also noted a positive correlation between mRNA level of the ESR1 gene and estrogen receptor status (RS=0.438, p<0.05).
Figure 1. Correlation between the normalized relative expression level (NRQ) of ESR1 and GPX1 genes.
Spearman’s rank correlation analysis results: Rs=0.454; p<0.05. (dotted lines: 95% Cl for regression line; n=33).
Figure 2. Correlation between the expression level of ESR1 and GPX1 normalized to expression level of the housekeeping gene (NQ) in non-malignant breast tissue samples.
Spearman’s rank correlation analysis results: Rs=0.450; p<0.05. (dotted lines: 95% Cl for regression line; n=35).
Figure 3. Correlation between the expression level of ESR1 and GPX1 normalized to expression level of the housekeeping gene (NQ) in tumorous breast tissue samples.
Spearman’s rank correlation analysis results: Rs=0.360; p<0.05. (dotted lines: 95% Cl for regression line; n=35).
Discussion
This study analyzed association between mRNA expression level of the GPX1 gene and mRNA level of the ESR1 gene in both, non-malignant and tumorous breast tissues, and evaluated a possible role of such relationship in the development of breast cancer.
The antioxidant defense is very important for maintaining tertiary structure of ERα which has been previously described for human MCF-7 breast cancer cell line in the case of which antioxidant enzymes, like Cu/ZnSOD and TrxR, interact with ERα to form a large protein complex, which migrates to the nucleus following the receptor activation (Schultz-Norton et al., 2008). This observation led us to investigate an association between mRNA level of the ESR1 gene and GPX1, yet another crucial antioxidant enzyme, even though it is not involved in the abovementioned protein complex.
In the study presented here we demonstrated that expression level of the ESR1 gene was significantly decreased in tumorous breast tissue when compared to the adjacent non-malignant one. This down-regulation of ESR1 was found to be related to the histological grade of the tumor and decreased significantly with increasing grade of cancer. It is known that receptor status can change as the tumor progresses (Amir et al., 2012). In very high-grade cancers this expression decreases or can even be lost (Huang et al., 2014; Stierer et al., 1993). Such trend was also observed in our study. In patients with the G1 breast cancer, the ESR1 expression levels did not differ significantly between malignant and paired non-malignant breast tissue, nevertheless, the ESR1 expression was significantly reduced in malignant breast tissue of the G2 and G3 breast cancer patients. The overall down-regulation of ESR1 expression observed when all samples were analyzed together can be explained by the structure of the group of patients examined in this study, with G2 and G3 patients accounting for 84% of all patients, which may have significantly influenced the level of ESR1 expression measured in the whole group of patients. The expression level of ESR1 varies depending on the progesterone receptor status. We found that the down-regulation of ESR1 expression in malignant breast tissue when compared to a paired non-malignant one was significantly much more pronounced among patients with a negative progesterone receptor status when compared to those with a positive progesterone receptor status. This observation may be related to the fact that activated estrogen receptor alpha induces transcription of the progesterone receptor (Kastner et al., 1990). Reciprocally, the lack of progesterone receptor may thus be seen as a consequence of reduced activity of ERα, which in turn may results from reduced amount of ERα due to down-regulated expression of ESR1.
It is noteworthy that the down-regulation of ESR1 expression relates particularly to the group of patients with positive estrogen receptor status, shortage of progesterone receptor activity, negative Her/neu-2 status and more advanced/bigger tumors (T2). We observed this down-regulation separately in all of the abovementioned subgroups, but considering the limited size of the study group we were unable to assess whether such ESR1 down-regulation would be also observed in a group of patients presenting all of these clinicopathological features together. Such an observation would be very interesting and would allow one to answer the question if, from a genetics point of view, the bigger tumors with negative HER/neu-2 status and lacking the progesterone receptor, tend to transform into the triple-negative subtype (TN) of breast cancer (with negative estrogen/progesterone receptor and Her/neu-2 status) or into tumors with decreased expression of ERα (ER-) instead. Tumors transformed into the TN or ER- type are highly undesirable. These types of tumors are more aggressive than other subtypes of breast cancer and are characterized by poorer survival rates. This mainly follows from the fact that TN and ER- tumors are the most difficult ones to be treated because of the lack of benefits from the endocrine therapy and molecular targeted treatments for Her/nau-2 (Qiu et al., 2016).
The level of enzymatic activity and protein concentration of GPx-1 in tumor tissue has been broadly investigated in relation to breast cancer (Tas et al., 2005; Kumaraguruparan et al., 2002; Punnonen et al., 1994; Portakal et al., 2000). Those studies have shown an increased activity in tumor tissue when compared to the normal one. Contrary to immunocytochemical research, we evidenced the down-regulation of GPX1 mRNA expression in tumorous breast tissue as compared to the paired non-malignant tissue samples. This finding seems analogical to the results of other previous studies that have reported lowered expression of GPX1 mRNA in colorectal (Nalkiran et al., 2015) and gastric (Min et al., 2012) cancer. In the case of gastric cancer, almost 25% of the cases even lacked the GPX1 expression. These outcomes were associated with an advanced gastric cancer, lymphatic invasion, aggressiveness of this cancer and poor patient survival (Min et al., 2012). In our study, the level of the GPX1 transcript was found to be down-regulated independently of the clinicopathological factors.
Down-regulation of the GPX1 gene in tumorous tissue may lead to decreased GPx-1 protein level and in consequence to reduction of its enzymatic activity. Shortage in the antioxidant defense may lead to increased oxidative stress in cells which may possibly have two mutually opposite effects: excessive levels of ROS may induce the carcinogenesis process and progression of cancer on one hand, but at the same time may be toxic to cancer cells on the other one (Barrera, 2012).
Induction of increased level of ROS in cancer cells is an often used chemotherapeutic approach. Chemotherapeutic agents, such as vinblastine, cisplatin, mitomycin C or doxorubicin, exert their anticancer activity by inducing the ROS-dependent apoptosis of cancer cells (Chiu et al., 2012; Casares et al., 2012; Kim et al., 2012). Hence, declined antioxidant response in cancer cells, due to down-regulated GPX1, for example, may be of benefit for further treatment.
In addition to a separate analysis of ESR1 and GPX1 transcript levels, we also analyzed the relationship between these two genes. We found a significant positive correlation between the levels of GPX1 and ESR1 transcripts, regardless of the tissue type. These results allow us to hypothesize that expression levels of the GPX1 and ESR1 genes are mutually inter-related, even though GPx-1 has not been previously identified among proteins involved in the formation of the protein-ERα-ERE complex. Moreover, research studies performed up to date have not defined any interaction mechanism between ERα and GPx-1 at the protein level, as well as any molecular relationships between genes encoding these proteins (e.g. mediated by common transcription factors). Based on the data presented here, we hypothesize that the down-regulation of GPX1 expression may lead to increased oxidative stress in tumorous breast tissue, which in turn may lead to a decreased expression of the ESR1 gene. This may, however, be contradictory to a previous study, according to which the oxidative stress induced by hydrogen peroxide, the main substrate of GPx-1, has only a minimal effect on the ERα level in MCF-7 cells (Tamir et al., 2002). On the other hand, interaction between the GPX1 and ESR1 gene expression can be opposite. In MCF-7 cells, it was observed that physiological concentration of 17-β-estradiol acts through the membrane-located estrogen receptors on activities of the MAP kinase (MAPK) and NFκB. It was shown that activation of MAPK and NFκB by estrogen, up-regulates expression of the Mn-SOD and GPx-1 antioxidant enzymes (Borras et al., 2005). Thus, this aspect definitely remains open and deserves further investigation.
The major weakness of the study concerns a relatively small sample size, which limited the possibility to perform a more advanced statistical analysis of the data. Also, the lack of information about the further course of treatment does not allow us to draw extensive conclusions about the influence of the ESR1 and GPX1 genes’ expression level on the effectiveness of the therapy.
In summary, our study provides evidence in favor of the significant down-regulation of ESR1 and GPX1 expression in malignant breast tissue when compared to the adjacent non-malignant breast tissue. The correlation between these genes was significantly positive regardless of the type of tissue. The extent of down-regulation of ESR1 in tumorous tissue as compared to the paired non-malignant breast tissue was dependent on clinicopathological factors and was mostly related to the histological grade and progesterone receptor status, while the GPX1 expression was reduced in tumorous tissue when compared to the surrounding non-malignant one, independently of the clinicopathological breast cancer features.
Based on our data, it seems evident that further research is needed in order to fully elucidate the mechanism underlying association between expression level of the ESR1 and GPX1 genes in the malignant and adjacent non-malignant breast tissue.
Conflict of interest
The authors declare that they have no conflict of interest.
Ethical approval
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional research committee (resolution no. 01/2011) and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
Informed consent
Informed consent was obtained from all individual participants included in the study.
Acknowledgements of Financial Support
This study was funded by the Polish Ministry of Science and Higher Education as the internal grant of the Nofer Institute of Occupational Medicine (grant number: IMP1.12/2012-2014).
References
Amir E, Clemons M, Purdie CA, Miller N, Quinlan P, Geddie W, Coleman RE, Freedman OC, Jordan LB, Thompson AM (2012) Tissue confirmation of disease recurrence in breast cancer patients: pooled analysis of multi-centre multi-disciplinary prospective studies. Cancer Treat Rev 38: 708–714. doi: 101016/jctrv201111006
Arnér ESJ, Holmgren A (2000) Physiological functions of thioredoxin and thioredoxin reductase. Eur J Biochem 267: 6102–6109. doi: 101046/j1432-1327200001701x
Au WW, Abdou-Salama S, Al-Hendy A (2007) Inhibition of growth of cervical cancer cells using a dominant negative estrogen receptor gene. Gynecol Oncol 104: 276–280. doi: 101016/jygyno200610015
Barrera G (2012) Oxidative Stress and lipid peroxidation products in cancer progression and therapy. ISRN Oncol 2012: 1–21. doi: 105402/2012/137289
Behrens D, Gill JH, Fichtner I (2007) Loss of tumourigenicity of stably ERbeta-transfected MCF-7 breast cancer cells. Mol Cell Endocrinol 274: 19–29. doi: 101016/jmce200705012
Bojar I, Cvejić R, Głowacka MD, Koprowicz A, Humeniuk E, Owoc A (2012) Morbidity and mortality due to cervical cancer in Poland after introduction of the Act – National Programme for Control of Cancerous Diseases. Ann Agric Environ Med 19: 680–685
Borras C, Gambini J, Gomez-Cabrera MC, SastreJ, Pallardo FV, Mann GE, Vina J (2005) 17B-Oestradiol up-regulates longevity-related antioxidant enzyme expression via the ERK1 and ERK2[MAPK]/NFkB cascade. Aging Cell 4: 113–118. doi: 101111/j1474-9726200500151x
Casares C, Ramirez-Camacho R, Trinidad A, Roldan A, Jorge E, Garcia-Berrocal JR (2012) Reactive oxygen species in apoptosis induced by cisplatin: review of physiopathological mechanisms in animal models. Eur Arch Oto-Rhino-Laryngology 269: 2455–2459. doi: 101007/s00405-012-2029-0
Chiu WH, Luo SJ, Chen CL, Cheng JH, Hsieh CY, Wang CY, Huang WC, Su WC, Lin CF (2012) Vinca alkaloids cause aberrant ROS-mediated JNK activation Mcl-1 downregulation DNA damage mitochondrial dysfunction and apoptosis in lung adenocarcinoma cells. Biochem Pharmacol 83: 1159–1171. doi: 101016/jbcp201201016
Huang B, Omoto Y, Iwase H, Yamashita H, Toyama T, Coombes RC, Filipovic A, Warner M, Gustafsson J-Å (2014) Differential expression of estrogen receptor Α β1 and β2 in lobular and ductal breast cancer. Proc Natl Acad Sci U S A 111: 1933–1938. doi: 101073/pnas1323719111
Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P (1990) Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9: 1603–1614. http://wwwpubmedcentralnihgov/articlerenderfcgi?artid=551856&tool=pmcentrez&rendertype=abstract
Kim KK, Lange TS, Singh RK, Brard LR, Moore G (2012) Tetrathiomolybdate sensitizes ovarian cancer cells to anticancer drugs doxorubicin fenretinide 5-fluorouracil and mitomycin C. BMC Cancer 12: 147. doi: 101186/1471-2407-12-147
Klinge CM (2001) Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res 29: 2905–2919. doi: 101093/nar/29142905
Kumaraguruparan R, Subapriya R, Viswanathan P, Nagini S (2002) Tissue lipid peroxidation and antioxidant status in patients with adenocarcinoma of the breast. Clin Chim Acta 325: 165–170
Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P (2000) Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74: 311–317. http://wwwncbinlmnihgov/pubmed/11162939
Liang X, Lu B, Scott GK, Chang CH, Baldwin MA Benz CC (1998) Oxidant stress impaired dna-binding of estrogen receptor from human breast cancer. Mol Cell Endocrinol 146: 151–161
Lin Z, Reierstad S, Huang C-C, Bulun SE (2007) Novel estrogen receptor-alpha binding sites and estradiol target genes identified by chromatin immunoprecipitation cloning in breast cancer. Cancer Res 67: 5017–5024. doi: 101158/0008-5472CAN-06-3696
Lubos E, Loscalzo J, Handy DE (2011) Glutathione peroxidase-1 in health and disease: from molecular mechanisms to therapeutic opportunities. Antioxid Redox Signal 15: 1957–1997. doi: 101089/ars20103586
Min S, Kim H, Jung E (2012) Prognostic significance of glutathione peroxidase 1 (GPX1) down-regulation and correlation with aberrant promoter methylation in human gastric cancer. Anticancer Res 32: 3169–3176. http://ariiarjournalsorg/content/32/8/3169short
Mustacich D, Powis G (2000) Thioredoxin reductase. Biochem J 346: 1–8 http://wwwpubmedcentralnihgov/articlerenderfcgi?artid=1220815&tool=pmcentrez&rendertype=abstract
Nalkiran I, Turan S, Arikan S, Kahraman ÖT, Acar L, Yaylim I, Ergen A (2015) Determination of gene expression and serum levels of MnSOD and GPX1 in colorectal cancer. Anticancer Res 35: 255–259. http://wwwncbinlmnihgov/pubmed/25550558
Paruthiyil S, Parmar H, Kerekatte V, Cunha GR, Firestone GL, Leitman DC (2004) Estrogen receptor beta inhibits human breast cancer cell proliferation and tumor formation by causing a G2 cell cycle arrest. Cancer Res 64: 423–428. http://wwwncbinlmnihgov/pubmed/14729654
Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30: e36. http://wwwpubmedcentralnihgov/articlerenderfcgi?artid=113859&tool=pmcentrez&rendertype=abstract
Portakal O, Ozkaya O, Inal ME, Bozan B, Kosan M, Sayek I (2000) Coenzyme Q10 concentrations and antoxidant status in tissues of breast cancer patients. Clin Biochem 33: 279–284
Punnonen K, Ahotupa M, Asaishi K, Hyoty M, Kudo R, Punnonen R (1994) Antioxidant enzyme activities and oxidative stress in human breast cancer. J Cancer Res Clin Oncol 120: 374–377. http://wwwncbinlmnihgov/pubmed/8138563
Qiu J, Xue X, Hu C, Xu H, Kou D, Li R, Li M (2016) Comparison of clinicopathological features and prognosis in triple-negative and non-triple negative breast cancer. J Cancer 7: 167–173. doi: 107150/jca10944
Rao AK, Ziegler YS, McLeod IX, Yates JR, Nardulli AM (2008) Effects of Cu/Zn superoxide dismutase on estrogen responsiveness and oxidative stress in human breast cancer cells. Mol Endocrinol 22: 1113–1124. doi: 101210/me2007-0381
Rao AK, Ziegler YS, McLeod IX, Yates JR, Nardulli AM (2009) Thioredoxin and thioredoxin reductase influence estrogen receptor alpha-mediated gene expression in human breast cancer cells. J Mol Endocrinol 43: 251–261. doi: 101677/JME-09-0053
Schafer FQ, Buettner GR (2001) Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free Radic Biol Med 30: 1191–1212. http://wwwncbinlmnihgov/pubmed/11368918
Schultz-Norton JR, Ziegler YS, Likhite VS, Yates JR, Nardulli AM (2008) Isolation of novel coregulatory protein networks associated with DNA-bound estrogen receptor alpha. BMC Mol Biol 9: 97. doi: 101186/1471-2199-9-97
Schwabe JW, Chapman L, Finch JT, Rhodes D (1993) The crystal structure of the estrogen receptor DNA-binding domain bound to dna: how receptors discriminate between their response elements. Cell 75: 567–578. http://wwwncbinlmnihgov/pubmed/8221895
Stierer M, Rosen H, Weber R, Hanak H, Spona J, Tüchler H (1993) Immunohistochemical and biochemical measurement of estrogen and progesterone receptors in primary breast cancer. Ann Surg 218: 13–21. http://wwwpubmedcentralnihgov/articlerenderfcgi?artid=1242895&tool=pmcentrez&rendertype=abstract
Ström A, Hartman J, Foster JS, Kietz S, Wimalasena J, Gustafsson J-A (2004) Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the breast cancer cell line T47D. Proc Natl Acad Sci U S A 101: 1566–1571. doi: 101073/pnas0308319100
Tamir S, Izrael S, Vaya J (2002) The effect of oxidative stress on ERalpha and ERbeta expression. J Steroid Biochem Mol Biol 81: 327–332. doi: 101016/S0960-0760(02)00115-2
Tas F, Hansel H, Belce A, Ilvan S, Argon A, Camlica H, Topuz E (2005) Oxidative stress in breast cancer. Med Oncol 22: 11–15. doi: 101385/MO:22:1:011
Valko M, Leibfritz D, Moncol J, Cronin MTD, Mazur M, Telser J (2007) Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 39: 44–84. doi: 101016/jbiocel200607001
Webster KA, Prentice H, Bishopric NH (2001) Oxidation of zinc finger transcription factors: physiological consequences. Antioxid Redox Signal 3: 535–548. doi: 101089/15230860152542916