Regular paper

Serum miR-21 predicts the prognosis of patients with primary gastrointestinal diffuse large B-cell lymphoma

Qing Ji1, Ting Jiang2, Jun Su1, Suyuan Zhang1, Chengfang Li1, Xiaorong Yang1, Xinglong Wu1, Jin Yao1, Dan Yuan1 and Jinjing Wang1✉

1Department of Pathology, the Affiliated Hospital of Zunyi Medical University, Zunyi, China; 2Department of Pathology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, China

Background: Primary gastrointestinal diffuse large B-cell lymphoma (PGI-DLBCL) lacks specific clinical manifestations and its malignancy renders prognostication and choice of treatment strategy difficult. The aim of this study was to evaluate microRNA (miR)-21 as potential non-invasive biomarkers for prognosis in PGI-DLBCL patients. Methods: Serum miR-21 expression in de novo PGI-DLBCL patients, consecutively enrolled for this study, was detected by quantitative real-time polymerase chain reaction (qRT-PCR). Relative expression was calculated using the comparative Ct method. Statistical significance was determined using the Mann-Whitney rank sum and Fisher’s exact test. Survival analysis was conducted using the Kaplan-Meier method. Results: Compared with healthy controls, serum miR-21 levels were significantly elevated in the PGI-DLBCL patients (n=156). The high expression level of serum miR-21 at diagnosis was associated with worse progression-free survival (PFS) (30 (9–42) vs 42 (12–52) months in high and low miR-21 groups) and overall survival (OS) (35 (15–52) vs 48 (17–61) months in high and low miR-21 groups) and was an independent risk factor for PFS and OS (hazard ratios 4.345 and 3.311, respectively). Furthermore, Bcl-2, Bcl-6 and Ki-67 were independently and positively associated with miR-21 expression. Conclusions: Our results suggest that miR-21 is a potential prognostic marker to predict clinical outcomes in PGI-DLBCL patients and a high miR-21 level is associated with poor outcomes.

Keywords: PGI-DLBCL, biomarkers, miR-21, prognosis, therapeutic outcomes

Received: 06 August, 2021; revised: 10 September, 2021; accepted: 09 May, 2022; available on-line: 12 June, 2022

✉e-mail: jinjingwangdr@yeah.net

Abbreviations: ANOVA, analysis of variance; Bcl-2, B cell lymphoma-2; Bcl-6, B cell lymphoma-6; CRP, c-reactive protein; ECOG, East-ern Cooperative Oncology Group; FFPE, formalin-fixed and paraffin-embedded; FISH, fluorescent in situ hybridization; GC, germinal center; HR, hazard ratio; IHC, immunohistochemistry; Lnc, long non-coding; miR, microRNA; NHL, non-Hodgkin’s lymphoma; non-GC, non-germinal center; OR, odds ratio; OS, overall survival; PD-1, programmed cell death protein 1; PD-L1,programmed cell death ligand 1; PFS, progression-free survival; PGI-DLBCL, primary gastrointestinal diffuse large B-cell lymphoma; PTEN, phosphatase and tensin homologue; qRT-PCR, quantitative real-time polymerase chain reaction; R-CHOP, rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone; SHIP1, Src homolo-gy-2 domain-containing inositol 5-phosphatase 1

Introduction

Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin’s lymphoma (NHL), counting for 30–40% of new hematological malignancies in different geographic regions (Li et al., 2018). Primary gastrointestinal diffuse large B-cell lymphoma (PGI-DLBCL) occurs mostly in extranodal sites such as the stomach (60–70%), followed by the small bowel, ileum, cecum, colon and rectum (d’Amore et al., 1994). It lacks specific clinical manifestations and has complex pathological features, resulting in difficult diagnosis and treatment (Ferreri & Montalban, 2007; Ruskone-Fourmestraux et al., 2003). Therefore, accurate prognostication is needed to help to design the initial treatment plan (Cabanillas & Shah, 2017; Nikonova et al., 2015). DLBCL has typical invasiveness and could be cured with chemotherapy and targeted therapy (Fu et al., 2008; Salles et al., 2020). However, the relationship between DLBCL subtypes based on the traditional morphological classification and therapeutic efficacy and prognosis is not fully clear. Advances in epigenetics have been made toward the biological diversity and signaling pathways involved in tumorigenesis. For example, microRNAs (miR) miR-155-5p and miR-21-5p have been found to be potentially useful for diagnosis (Larrabeiti-Etxebarria et al., 2019), long non-coding (lnc) RNA SNHG14/miR-5590-3p/ZEB1 are shown to form a positive feedback loop that promotes progression and immune evasion of DLBCL through regulating PD-1/PD-L1 checkpoint (Zhao et al., 2019), and circulating miRNAs are revealed to be capable of predicting relapse and survival in DLBCL patients (Sun et al., 2021).

MiR-21, as one of the most highly expressed members of the small non-coding miRNA family in many mammalian cell types (Lagos-Quintana et al., 2001), is considered to play key roles in many cellular processes, such as functioning as a key switch in the inflammatory response (Sheedy, 2015), promoting myocardial infarction-induced cardiac fibrosis (Yuan et al., 2017), affecting tumorigenesis by downregulating the expression of target genes (Liu et al., 2019; Song et al., 2014). It is also demonstrated as a promising biomarker for the early detection of colon cancer, especially in men (Dehghan et al., 2019), breast cancer (Anwar et al., 2019) and hepatocellular carcinoma (Guo et al., 2017). Furthermore, miR-21 and miR-155 overexpression may activate the AKT signaling pathway and down-regulation of tumor suppressors such as phosphatase and tensin homologue (PTEN), programmed cell death 4 (PDCD4), or Src homology-2 domain-containing inositol 5-phosphatase 1 (SHIP1) in natural killer-cell lymphoma/leukemia, leading to decreased apoptosis and increased proliferation of tumor cells (Yamanaka et al., 2009). High expression of miR-21 in malignant tissue and blood has been associated with DLBCL diagnosis (Chen et al., 2014; Lawrie et al., 2008). However, very few reports to date have evaluated the role of circulating miR-21 as a potential prognostic factor in DLBCL (Li et al., 2015) and whether it can be used as a prognostic marker in PGI-DLBCL is still unclear.

The goal of this study is to investigate the potential of serum miR-21 for prognostication of PGI-DLBCL to assist the management of the disease.

Materials and Methods

Study design, patients, and control subjects

This was a prospective, observational, non-interventional study on a cohort of newlydiagnosed de novo PGI-DLBCL adult patients consecutively enrolled at Zunyi Medical University between March 2014 and March 2018. All patients were treated with six courses of R-CHOP every 21 days (rituximab 375 mg/m2 day 1, cyclophosphamide 750 mg/m2 day 1, vincristine 1.4 mg/m2 day 1, doxorubicin 50 mg/m2 day 1, prednisone 100 mg days 1–5), followed by two adjunctive doses of rituximab (Khan et al., 2016; Shibata et al., 2017). Patients were included if he/she was equal to or older than 18 years, and histopathologically proven to have PGI-DLBCL. Patients were excluded because of comorbidity with other malignant tumors, blood system diseases and other life-threatening conditions that could compromise clinical outcomes.

This study was approved by the Ethics Committee of Zunyi Medical University, Zunyi, China, and all study participants provided written informed consent. All patients were treated according to ethical and legal standards adopted by the Declaration of Helsinki. Histological criteria for diagnosis and classification of DLBCL are those of the World Health Organization (WHO) classification (Swerdlow et al., 2016). Age- and gender-matched healthy controls were recruited at the same hospital from individuals performing a routine health checkup.

Assessments

Clinical assessment was performed by Ann Arbor stage and IPI evaluation (Ruppert et al., 2020)and the Eastern Cooperative Oncology Group (ECOG) performance status was assessed as previously (Prigerson et al., 2015). The cell of origin was determined by IHC using the Hans algorithm as germinalcenter (GC) or non- germinal center (non-GC) immunophenotype (Hans et al., 2004). Formalin-fixed and paraffin-embedded (FFPE) tumor sections were analyzed for Bcl-2, Bcl-6, c-Myc and ki67 expressions by interphase fluorescent in situ hybridization (FISH) as previously reported (Yan et al., 2014). Briefly, paraffin-embedded tissue slices were rehydrated by going through an ethanol serial and hybridized to fluorescent probes at room temperature for 2 h according to the supplier’s instructions. The probes for Bcl-2, Bcl-6, c-Myc and ki67 probes were purchased from Beyetime, Beijing. FISH signals were analyzed using a fluorescence microscope (Olympus BX51, Tokyo, Japan) equipped with a DP72 camera and DP2-BSW software (Olympus, Tokyo, Japan). Patient cases with break-apart signals in >10% of nuclei were considered positive for the presence of a translocation. The signal distributions were evaluated by two independent observers who were blinded to the patient information.

Baseline disease staging was determined according to the Lugano recommendations for non-Hodgkin lymphoma (Cheson et al., 2014). Symptoms such as drenching night sweats, fever (>38°C, lasting for more than 3 days), and unexplained loss of more than 10% body weight within 6 months, were recorded.

Data collection and follow-up

Demographic and clinical data were collected from the hospital medical databases, including age, gender, medications, and laboratory findings. All patients were followed up by monthly telephone interviews, during hospital visits and hospital readmission till July 2020. Overall survival (OS) was defined as the time interval between the date of initial diagnosis and the date of death from any cause, and progression-free survival (PFS) was defined as the time interval between the date of initial diagnosis and the date of disease progression or death from any cause, whichever occurred first.

RNA isolation from blood samples, cDNA synthesis and qRT-PCR

Five ml fasting blood samples were collected in the morning within 2 days following the diagnosis in tubes containing dipotassium ethylenediaminetetraacetic acid (EDTA K2) and centrifugated at 500×g for 10 min to collect serum. 500 μl was used for RNA extraction using Trizol reagents (CW0580S, Cwbiotech, Beijing) according to the supplier’s instructions and was reversely transcripted to cDNA using miRNA cDNA Synthesis kit (Cat. no: A28007, Thermo Fisher Scientific, USA) according to manufacturer’s protocols. HiScript II qRT SuperMix for qPCR (cat. no: R222-01, Vazyme, USA) was used to amplify the cDNA according to the manufacturer’s protocols. Normalization was done with U6 (forward: GCTTCGGCAGCACATATACTAAAAT, reverse: CGCTTCACGAATTTGCGTGTCAT). The PCR was performed in a total volume of 10 μl containing 1.5 μl of diluted and pre-amplified cDNA, 5 μl of 2×SYBR Green PCR Master Mix and 1 μl of each fluorescence probe. The cycling conditions were 50ºC for 2 min, 95ºC for 10 min followed by 45 cycles, each one consisting of 10 s at 95ºC and 30 s at 58ºC. Samples were run in triplicate and the mean value was calculated for each case. The data were managed according to the previously described protocol (Livak & Schmittgen, 2001). The primer sequences used for miR-21 were forward: 5’-GTGCAGGGTCCGACGGT. reverse: 5’-GCCGCTAGCTTATCAGACTGATG.

Statistical analysis

Descriptive statistics were calculated for all the variables of interest to summarize the patient’s characteristics. Statistical software (SPSS22.0) was used for statistical analysis. Measurement data with normal distribution were expressed as mean ± S.D. (standard derivation) and non-normal distribution data were expressed as a median. Counting data were expressed as a percentage. Analysis of variance (ANOVA) was used to compare normallydistributed variables, the Kruskal-Wallis test was employed for non-normally distributed variables, and the chi-square of Fisher’s exact test, as appropriate, was used for categorical data. Spearman rank correlation analysis was used to evaluate the relationship between serum miR-21 and non-normal variables. The Kaplan-Meier survival curve was used to display the survival times, which were compared using the log-rank test. Univariate and multivariate Cox regression models were used to analyze the relationship between serum miR-21 and clinicopathological factors, computed with the R package smoothHR as previously described (Meira-Machado et al., 2013). A value of P<0.05 was considered statistically significant.

Results

Patient characteristics

From March 2014 to March 2018, serum samples were collected from 176 newly diagnosed PGI-DLBCL patients who completed R-CHOP based treatment, 20 cases who did not complete the treatment courses were excluded in the present analysis (including 8 toxic deaths during treatment and 12 cases of loss of follow-up). Baseline clinical and biological features of 156 cases are shown in Table 1. The median age of the patients was 59.5 years, including 88 male and 68 female. The Ann Arbor stages of the patients ranged from I to IV with most of them being at stage III–IV. The IPI ranged from 0 to 5 and lactate dehydrogenase level was normal in half of the patients. Most of the cells of origin were GC and serum CRP level was elevated in about 50 % of patients. The proportion of Bcl-2, Bcl-6 and c-MYC positive cells was between 74% to 85 % (Table 1).

Serum miR-21 level was elevated in PGI-DLBCL patients

We first determined miR-21 levels in the 156 PGI-DLBCL patients and 52 healthy controls using qRT-PCR, and the results showed that the levels were significantly elevated in PGI-DLBCL patients as compared with healthy control (P<0.05, Fig. 1).

High miR-21 level was associated with poor outcomes

Since the relative miR-21 levels were highly variable in PGI-DLBCL patients, we stratified the patients into high (>5.2) and low (≤5.2) miR-21 level groups at the medium value (5.2) and analyzed their relationship with OS and PFS using the Kaplan-Meier survival curves. The median OS and PFS were 35 (15–52) and 30 (9–42) months in the high miR-21 level group and 48 (17–61) and 42 (12–52) months in the low miR-21 level group, respectively. The accumulated OS and PFS in the high miR-21 level group were significantly lower than those in the low miR-21 level group (P<0.01, Fig. 2).

With Cox regression analysis, miR-22 level, Bcl-2, Bcl-6 and Ki-67 expressions were found to be the factors independently affecting the probability of PFS and OS in our cohort of patients. For PFS, the hazard ratios were 4.345, 2.896, 2.104 and 2.779, and for OS, the hazard ratios were 3.311, 2.236, 2.214 and 2.169, respectively, while other factors such as Ann Arbor stage, IPI and Cell of origin were not significantly related to PFS and OS (Table 2).

Factors affecting miR-21 levels

Correlation analysis between miR-21 levels and clinicopathological characteristics and cancer-related genes showed that miR-21 level was closely associated with Ann Arbor stages and IPI grades, Bcl-2, Bcl-6, c-MYC and Ki-67 expressions, while other factors such as age, gender, lactate dehydrogenase, cell origin and serum CRP were not significantly related to miR-21 levels (Table 3) and logistic regression analysis showed that Bcl-2, Bcl-6 and Ki-67 were independently and positively associated with miR-21 expression (Table 4, P<0.05), but not with Ann Arbor stages, IPI grades or c-MYC.

Discussion

MiR-21 is located on human chromosome 17q23.2 and plays a crucial role in a variety of biological functions and diseases including development, cancer, cardiovascular diseases, and inflammation (Kumarswamy et al., 2011). Our study showed that serum miR-21 expression is elevated in PGI-DLBCL patients, high miR-21 level is associated with poor therapeutic outcomes and related to Bcl-2, Bcl-6, and Ki-67 expressions. These findings demonstrate that miR-21 has prognostic value for PGI-DLBCL and could be used to assess the therapeutic progression and outcomes for PGI-DLBCL patients.

Mature miR-21 is processed from primiR-21 (primary transcript containing miR-21) located within the intronic region of the TMEM49 gene. Expression of miR-21 has been found upregulated in many types of cancers including DLBCL (Lawrie et al., 2007, 2008) and miR-21, therefore. is classified as an oncomiR (Ribas & Lupold, 2010) and proposed to be a potential non-invasive diagnostic marker for DLBCL and possibly other cancers (Lawrie et al., 2008). Our analysis also showed that miR-21 is elevated in PGI-DLBCL patients as compared with healthy controls. Moreover, high miR-21 expression is associated with low OS and PFS. This is consistent with early results that circulating miR-21 level in DLBCL patients is higher than those in serum of control healthy cases (Chen et al., 2014). However, we did not find a correlation between the miR-21 level and tumor stage while in the early study, the miR-21 level was higher in stages I and II than in stages III and IV (Chen et al., 2014). The reason for this is unclear. In addition, miR-21 expression is also elevated in natural killer-cell lymphoma/leukemia (Yamanaka et al., 2009), Hodgkin lymphoma cell lines (Gibcus et al., 2009) and primary central nervous system lymphoma (Baraniskin et al., 2012). All these findings suggest that miR-21 is an oncogene that promotes the occurrence and development of lymphoma. Mice overexpressing miR-21 leads to a pre-B malignant lymphoid-like phenotype with increased size and weight of hematopoietic organs such as spleen, bone marrow and thymus and when miR-21 was inactivated, the tumors regressed completely in a few days. These results demonstrate that miR-21 may be targeted for human cancer treatment, such as through inactivation (Medina et al., 2010) since the main target gene of miR-21 is the classical tumor suppressor gene phosphatase and tensin homolog (PTEN) that suppresses the P13K/Akt signaling pathways and promotes the proliferation of tumor cells (Rai et al., 2008).

In addition, studies have shown that miR-21 also acts as an oncogene in other tumors. It is highly expressed in breast tumors. Once inhibited with anti-miR-21 oligonucleotides, increased apoptosis and decreased cell growth are induced in breast cancer cells and cell proliferation is suppressed, partially due to downregulation of the antiapoptotic Bcl-2 in anti-miR-21-treated tumor cells (Si et al., 2007). In colon cancer, miR-21 is found to be an independent prognostic indicator and the high expression indicates poor survival and poor therapeutic outcome (Schetter et al., 2008). In pancreatic cancers, although miR-21 expression does not correlate with tumor size, differentiation, nodal status, or T stage, strong miR-21 expression is predictive of poorer outcomes compared to absent or faint/focal miR-21 expression in patients (Dillhoff et al., 2008).

The molecular pathogenesis of PGI-DLBCL is similar to that of primary lymph nodes DLBCL and most DLBCLs derive from germinal center B-cells. The initiation and maintenance of the GC are dependent on BCL-6, a transcriptional repressor belonging to the BTB/POZ/Zinc Finger family of transcription factors. It is activated via translocation activation to suppress transcription, affecting the expression of genes involved in the activation and differentiation of B cells, as well as genes related to cell cycle and apoptosis, resulting in a rapid proliferative but undifferentiated state and subsequently DLBCL (Schneider et al., 2011). Another gene prone to translocation is Bcl-2. In the normal B cell differentiation, this gene is not expressed in GC, but expressed once it is translocated with the J subexons of the immunoglobulin heavy chain (IgH), leading to increased anti-apoptotic ability and tumorigenesis (Nambiar et al., 2011). Our analysis showed that Bcl-2 and Bcl-6 expressions are related to miR-21 level in these patients. Therefore, it is worthy to investigate how these genes interact to modulate the progress of DLBCL. Previously, miR-211 was found to target Bcl-2 to regulate autophagy and apoptosis in cervical cancer (Liu et al., 2020) and Bcl-6 could be downregulated by the miR-30 family in B-lymphocytes and lymphoma cells (Lin et al., 2011), suggesting that the correlation between miR-21 and Bcl-2 and Bcl-6 may result from interactions between these molecules, although the mechanisms are still unclear.

There are limitations to our study. As a single center, observational study, the sample size is relatively small and the follow-up time is not long enough to generate long term outcome results. Therefore, prospective, large-scale, multicenter studies are necessary to confirm our results and the mechanisms of interaction between this miRNA and proteins in DLBCL warrants investigations.

Conclusions

Our data demonstrate that serum miR-21 level is significantly elevated in the PGI-DLBCL patients, a high expression level of serum miR-21 is associated with worse PFS and OS. miR-21 is an independent risk factor for PFS and OS, and is also closely related to the expression of Bcl-2, Bcl-6, and Ki-67. Therefore, serum miR-21 may be used as a biomarker to monitor and manage the treatment progress and prognosis of PGI-DLBCL.

Declarations

Ethics approval and consent to participate: the Ethics Committee of Zunyi Medical University and written informed consent were obtained from every participant.

Consent for publication: N/A.

Availability of data and material: The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Competing interests: None.

Funding: None.

Acknowledge: Not applicable.

References

Anwar SL, Sari DNI, Kartika AI, Fitria MS, Tanjung DS, Rakhmina D, Wardana T, Astuti I, Haryana SM, Aryandono T (2019) Upregulation of circulating MiR-21 expression as a potential biomarker for therapeutic monitoring and clinical outcome in breast cancer. Asian Pac J Cancer Prev 20: 1223–1228. https://doi.org/10.31557/APJCP.2019.20.4.1223

Baraniskin A, Kuhnhenn J, Schlegel U, Maghnouj A, Zollner H, Schmiegel W, Hahn S, Schroers R (2012) Identification of microRNAs in the cerebrospinal fluid as biomarker for the diagnosis of glioma. Neuro Oncol 14: 29–33. https://doi.org/10.1093/neuonc/nor169

Cabanillas F, Shah B (2017) Advances in diagnosis and management of diffuse large B-cell lymphoma. Clin Lymphoma Myeloma Leuk 17: 783–796. https://doi.org/10.1016/j.clml.2017.10.007

Chen W, Wang H, Chen H, Liu S, Lu H, Kong D, Huang X, Kong Q, Lu Z (2014) Clinical significance and detection of microRNA-21 in serum of patients with diffuse large B-cell lymphoma in Chinese population. Eur J Haematol 92: 407–412. https://doi.org/10.1111/ejh.12263

Cheson BD, Fisher RI, Barrington SF, Cavalli F, Schwartz LH, Zucca E, Lister TA; Alliance, Australasian Leukaemia and Lymphoma Group; Eastern Cooperative Oncology Group; European Mantle Cell Lymphoma Consortium; Italian Lymphoma Foundation; European Organisation for Research; Treatment of Cancer/Dutch Hemato-Oncology Group; Grupo Español de Médula Ósea; German High-Grade Lymphoma Study Group; German Hodgkin’s Study Group; Japanese Lymphorra Study Group; Lymphoma Study Association; NCIC Clinical Trials Group; Nordic Lymphoma Study Group; Southwest Oncology Group; United Kingdom National Cancer Research Institute (2014) Recommendations for initial evaluation, staging, and response assessment of Hodgkin and non-Hodgkin lymphoma: the Lugano classification. J Clin Oncol 32: 3059–3068. https://doi.org/10.1200/JCO.2013.54.8800

d’Amore F, Brincker H, Gronbaek K, Thorling K, Pedersen M, Jensen MK, Andersen E, Pedersen NT, Mortensen LS (1994) Non-Hodgkin’s lymphoma of the gastrointestinal tract: a population-based analysis of incidence, geographic distribution, clinicopathologic presentation features, and prognosis. Danish Lymphoma Study Group. J Clin Oncol 12: 1673–1684. https://doi.org/10.1200/JCO.1994.12.8.1673

Dehghan F, Boozarpour S, Torabizadeh Z, Alijanpour S (2019) miR-21: a promising biomarker for the early detection of colon cancer. Onco Targets Ther 12: 5601–5607. https://doi.org/10.2147/OTT.S199508

Dillhoff M, Liu J, Frankel W, Croce C, Bloomston M (2008) MicroRNA-21 is overexpressed in pancreatic cancer and a potential predictor of survival. J Gastrointest Surg 12: 2171–2176. https://doi.org/10.1007/s11605-008-0584-x

Ferreri AJ, Montalban C (2007) Primary diffuse large B-cell lymphoma of the stomach. Crit Rev Oncol Hematol 63: 65–71. https://doi.org/10.1016/j.critrevonc.2007.01.003

Fu K, Weisenburger DD, Choi WW, Perry KD, Smith LM, Shi X, Hans CP, Greiner TC, Bierman PJ, Bociek RG, Armitage JO, Chan WC, Vose JM (2008) Addition of rituximab to standard chemotherapy improves the survival of both the germinal center B-cell-like and non-germinal center B-cell-like subtypes of diffuse large B-cell lymphoma. J Clin Oncol 26: 4587–4594. https://doi.org/10.1200/JCO.2007.15.9277

Gibcus JH, Tan LP, Harms G, Schakel RN, de Jong D, Blokzijl T, Moller P, Poppema S, Kroesen BJ, van den Berg A (2009) Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia 11: 167–176. https://doi.org/10.1593/neo.08980

Guo X, Lv X, Lv X, Ma Y, Chen L, Chen Y (2017) Circulating miR-21 serves as a serum biomarker for hepatocellular carcinoma and correlated with distant metastasis. Oncotarget 8: 44050–44058. https://doi.org/10.18632/oncotarget.17211

Hans CP, Weisenburger DD, Greiner TC, Gascoyne RD, Delabie J, Ott G, Muller-Hermelink HK, Campo E, Braziel RM, Jaffe ES, Pan Z, Farinha P, Smith LM, Falini B, Banham AH, Rosenwald A, Staudt LM, Connors JM, Armitage JO, Chan WC (2004) Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood 103: 275–282. https://doi.org/10.1182/blood-2003-05-1545

Khan MA, Garg K, Bhurani D, Agarwal NB (2016) Early manifestation of mild cognitive impairment in B-cell non-Hodgkin’s lymphoma patients receiving CHOP and rituximab-CHOP chemotherapy. Naunyn Schmiedebergs Arch Pharmacol 389: 1253–1265. https://doi.org/10.1007/s00210-016-1290-y

Kumarswamy R, Volkmann I, Thum T (2011) Regulation and function of miRNA-21 in health and disease. RNA Biol 8: 706–713. https://doi.org/10.4161/rna.8.5.16154

Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T (2001) Identification of novel genes coding for small expressed RNAs. Science (1979) 294: 853–858. https://doi.org/10.1126/science.1064921

Larrabeiti-Etxebarria A, Lopez-Santillan M, Santos-Zorrozua B, Lopez-Lopez E, Garcia-Orad A (2019) Systematic review of the potential of MicroRNAs in diffuse large B cell lymphoma. Cancers (Basel) 11: https://doi.org/10.3390/cancers11020144

Lawrie CH, Soneji S, Marafioti T, Cooper CD, Palazzo S, Paterson JC, Cattan H, Enver T, Mager R, Boultwood J, Wainscoat JS, Hatton CS (2007) MicroRNA expression distinguishes between germinal center B cell-like and activated B cell-like subtypes of diffuse large B cell lymphoma. Int J Cancer 121: 1156–1161. https://doi.org/10.1002/ijc.22800

Lawrie CH, Gal S, Dunlop HM, Pushkaran B, Liggins AP, Pulford K, Banham AH, Pezzella F, Boultwood J, Wainscoat JS, Hatton CS, Harris AL (2008) Detection of elevated levels of tumour-associated microRNAs in serum of patients with diffuse large B-cell lymphoma. Br J Haematol 141: 672–675. https://doi.org/10.1111/j.1365-2141.2008.07077.x

Li J, Fu R, Yang L, Tu W (2015) miR-21 expression predicts prognosis in diffuse large B-cell lymphoma. Int J Clin Exp Pathol 8: 15019–15024

Li S, Young KH, Medeiros LJ (2018) Diffuse large B-cell lymphoma. Pathology 50: 74–87. https://doi.org/10.1016/j.pathol.2017.09.006

Lin J, Lwin T, Zhao JJ, Tam W, Choi YS, Moscinski LC, Dalton WS, Sotomayor EM, Wright KL, Tao J (2011) Follicular dendritic cell-induced microRNA-mediated upregulation of PRDM1 and downregulation of BCL-6 in non-Hodgkin’s B-cell lymphomas. Leukemia 25: 145–152. https://doi.org/10.1038/leu.2010.230

Liu HY, Zhang YY, Zhu BL, Feng FZ, Yan H, Zhang HY, Zhou B (2019) miR-21 regulates the proliferation and apoptosis of ovarian cancer cells through PTEN/PI3K/AKT. Eur Rev Med Pharmacol Sci 23: 4149–4155. https://doi.org/10.26355/eurrev_201905_17917

Liu S, Wang H, Mu J, Wang H, Peng Y, Li Q, Mao D, Guo L (2020) MiRNA-211 triggers an autophagy-dependent apoptosis in cervical cancer cells: regulation of Bcl-2. Naunyn Schmiedebergs Arch Pharmacol 393: 359–370. https://doi.org/10.1007/s00210-019-01720-4

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) Method. Methods 25: 402–408. https://doi.org/10.1006/meth.2001.1262

Medina PP, Nolde M, Slack FJ (2010) OncomiR addiction in an in vivo model of microRNA-21-induced pre-B-cell lymphoma. Nature 467: 86–90. https://doi.org/10.1038/nature09284

Meira-Machado L, Cadarso-Suarez C, Gude F, Araujo A (2013) smoothHR: an R package for pointwise nonparametric estimation of hazard ratio curves of continuous predictors. Comput Math Methods Med 2013: 745742. https://doi.org/10.1155/2013/745742

Nambiar M, Goldsmith G, Moorthy BT, Lieber MR, Joshi M v, Choudhary B, Hosur R v, Raghavan SC (2011) Formation of a G-quadruplex at the BCL2 major breakpoint region of the t (14;18) translocation in follicular lymphoma. Nucleic Acids Res 39: 936–948. https://doi.org/10.1093/nar/gkq824

Nikonova A, Guirguis HR, Buckstein R, Cheung MC (2015) Predictors of delay in diagnosis and treatment in diffuse large B-cell lymphoma and impact on survival. Br J Haematol 168: 492–500. https://doi.org/10.1111/bjh.13150

Prigerson HG, Bao Y, Shah MA, Paulk ME, LeBlanc TW, Schneider BJ, Garrido MM, Reid MC, Berlin DA, Adelson KB, Neugut AI, Maciejewski PK (2015) Chemotherapy use, performance status, and quality of life at the end of life. JAMA Oncol 1: 778–784. https://doi.org/10.1001/jamaoncol.2015.2378

Rai D, Karanti S, Jung I, Dahia PL, Aguiar RC (2008) Coordinated expression of microRNA-155 and predicted target genes in diffuse large B-cell lymphoma. Cancer Genet Cytogenet 181: 8–15. https://doi.org/10.1016/j.cancergencyto.2007.10.008

Ribas J, Lupold SE (2010) The transcriptional regulation of miR-21, its multiple transcripts, and their implication in prostate cancer. Cell Cycle 9: 923–929. https://doi.org/10.4161/cc.9.5.10930

Ruppert AS, Dixon JG, Salles G, Wall A, Cunningham D, Poeschel V, Haioun C, Tilly H, Ghesquieres H, Ziepert M, Flament J, Flowers C, Shi Q, Schmitz N (2020) International prognostic indices in diffuse large B-cell lymphoma: a comparison of IPI, R-IPI, and NCCN-IPI. Blood 135: 2041–2048. https://doi.org/10.1182/blood.2019002729

Ruskone-Fourmestraux A, Dragosics B, Morgner A, Wotherspoon A, de Jong D (2003) Paris staging system for primary gastrointestinal lymphomas. Gut 52: 912–913. https://doi.org/10.1136/gut.52.6.912

Salles G, Duell J, Gonzalez Barca E, Tournilhac O, Jurczak W, Liberati AM, Nagy Z, Obr A, Gaidano G, Andre M, Kalakonda N, Dreyling M, Weirather J, Dirnberger-Hertweck M, Ambarkhane S, Fingerle-Rowson G, Maddocks K (2020) Tafasitamab plus lenalidomide in relapsed or refractory diffuse large B-cell lymphoma (L-MIND): a multicentre, prospective, single-arm, phase 2 study. Lancet Oncol 21: 978–988. https://doi.org/10.1016/S1470-2045(20)30225-4

Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, Yuen ST, Chan TL, Kwong DL, Au GK, Liu CG, Calin GA, Croce CM, Harris CC (2008) MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA 299: 425–436. https://doi.org/10.1001/jama.299.4.425

Schneider C, Pasqualucci L, Dalla-Favera R (2011) Molecular pathogenesis of diffuse large B-cell lymphoma. Semin Diagn Pathol 28: 167–177. https://doi.org/10.1053/j.semdp.2011.04.001

Sheedy FJ (2015) Turning 21: Induction of miR-21 as a key switch in the inflammatory response. Front Immunol 6: 19. https://doi.org/10.3389/fimmu.2015.00019

Shibata Y, Hara T, Kasahara S, Yamada T, Sawada M, Mabuchi R, Matsumoto T, Nakamura N, Nakamura H, Ninomiya S, Kitagawa J, Kanemura N, Kito Y, Goto N, Miyazaki T, Takami T, Takeuchi T, Shimizu M, Tsurumi H (2017) CHOP or THP-COP regimens in the treatment of newly diagnosed peripheral T-cell lymphoma, not otherwise specified: a comparison of doxorubicin and pirarubicin. Hematol Oncol 35: 163–171. https://doi.org/10.1002/hon.2262

Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY (2007) miR-21-mediated tumor growth. Oncogene 26: 2799–2803. https://doi.org/10.1038/sj.onc.1210083

Song GQ, Gu L, He BS, Pan YQ, Wang SK (2014) Expression of MiRNA-21 in diffuse large B cell lymphoma and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi 22: 1603–1609. (in Chinese)https://doi.org/10.7534/j.issn.1009-2137.2014.06.019

Sun R, Zheng Z, Wang L, Cheng S, Shi Q, Qu B, Fu D, Leboeuf C, Zhao Y, Ye J, Janin A, Zhao WL (2021) A novel prognostic model based on four circulating miRNA in diffuse large B-cell lymphoma: implications for the roles of MDSC and Th17 cells in lymphoma progression. Mol Oncol 15: 246–261. https://doi.org/10.1002/1878-0261.12834

Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, Advani R, Ghielmini M, Salles GA, Zelenetz AD, Jaffe ES (2016) The 2016 revision of the World Health Organization classification of lymphoid neoplasms. Blood 127: 2375–2390. https://doi.org/10.1182/blood-2016-01-643569

Yamanaka Y, Tagawa H, Takahashi N, Watanabe A, Guo YM, Iwamoto K, Yamashita J, Saitoh H, Kameoka Y, Shimizu N, Ichinohasama R, Sawada K (2009) Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia. Blood 114: 3265–3275. https://doi.org/10.1182/blood-2009-06-222794

Yan LX, Liu YH, Luo DL, Zhang F, Cheng Y, Luo XL, Xu J, Cheng J, Zhuang HG (2014) MYC expression in concert with BCL2 and BCL6 expression predicts outcome in Chinese patients with diffuse large B-cell lymphoma, not otherwise specified. PLoS One 9: e104068. https://doi.org/10.1371/journal.pone.0104068

Yuan J, Chen H, Ge D, Xu Y, Xu H, Yang Y, Gu M, Zhou Y, Zhu J, Ge T, Chen Q, Gao Y, Wang Y, Li X, Zhao Y (2017) Mir-21 promotes cardiac fibrosis after myocardial infarction via targeting Smad7. Cell Physiol Biochem 42: 2207–2219. https://doi.org/10.1159/000479995

Zhao L, Liu Y, Zhang J, Liu Y, Qi Q (2019) LncRNA SNHG14/miR-5590-3p/ZEB1 positive feedback loop promoted diffuse large B cell lymphoma progression and immune evasion through regulating PD-1/PD-L1 checkpoint. Cell Death Dis 10: 731. https://doi.org/10.1038/s41419-019-1886-5