Regular paper

Effects of Baimuxinol on the inflammation and oxidative
stress of LPS-induced RAW264.7 macrophages via regulating
the NF-κB/IκBα and Nrf2/ARE signaling pathway

Yan Chen1, Nan Chen1, Jing Wang2 and Shuqing Li1✉

1Department of critical care, Taizhou Hospital of traditional Chinese Medicine, Taizhou, Jiangsu, China; 2Department of emergency, Taizhou Hospital of traditional Chinese Medicine, Taizhou, Jiangsu, China

Baimuxinol (BAI) is a sesquiterpenoid compound isolated from agarwood. This study aimed to investigate the specific mechanism of BAI on the inflammation as well as oxidative stress of RAW264.7 cells induced by lipopolysaccharide (LPS). The proliferation and cell viability were detected with EdU and MTT assay. The levels of inflammatory factors and antioxidant-related indexes were determined with corresponding kits. The qRT-PCR and western blot assays were performed to detect the expression of the related genes. We found that compared with the control group, cell viability and proliferation of the RAW264.7 cells was increased in the LPS group, while it was decreased in the BAI groups. In addition, in the LPS group, the contents of TNF-α, IL-1β, IL-6, ROS, MDA, PC and 8-OHdG were increased, the activities of T-SOD and CAT were decreased in comparison with the control group. It was reversed after BAI treatment. Finally, we confirmed that the NF-κB/IκBα signaling pathway is inhibited and the Nrf2/ARE signaling pathway is activated after BAI treatment. BAI relieved inflammation and oxidative stress of RAW264.7 macrophages induced by LPS through regulating the NF-κB/IκBα and Nrf2/ARE signaling pathway, which provided a novel insight for the therapy of sepsis.

Keywords: Baimuxinol, oxidative stress, lipopolysaccharide, proliferation, viability

Received: 11 February, 2022; revised: 16 March, 2022; accepted:
01 November, 2022; available on-line: 11 February, 2023

✉e-mail: chenqy_yan@163.com

Acknowledgements of Financial Support: The study was supported by Taizhou TCM science and technology development project(TZ202203)

Abbreviations: BAI, Baimuxinol; CAT, catalase; HO-1, heme oxygenase-1; IL-1β, interleukin 1β; IL-6, interleukin 6; LPS, lipopolysaccharide; MDA, malondialdehyde; PC, protein crbonyal; ROS, reactive oxygen species; SOD, superoxide dismutase; TNF-α, tumor necrosis factor α

Introduction

Sepsis is a systemic inflammatory response syndrome, which refers to organ dysfunction caused by host response disorder. It is a serious life-threatening disease, not only has a high incidence rate and mortality but also takes up a lot of medical resources (Arefian et al., 2017). In 2016, the global medical community redefined sepsis, pointing out that sepsis is a fatal organ dysfunction due to the infection (Singer et al., 2016). At present, despite the advances in antibiotic therapy (Alhashem et al., 2017), mechanical therapy (Zampieri et al., 2017), maintaining blood glucose balance (Dellinger et al., 2008) and other treatment methods, severe sepsis is still the main cause of death. In addition, in the process of an inflammatory response, macrophages recognize pathogen/injury-related molecular patterns such as lipopolysaccharide (LPS) through toll-like receptor 4 (TLR4) and other pattern recognition receptors expressed on their cell membrane and then activate downstream signaling pathways, such as NF-κb and MAPKs (Lancaster et al., 2018). Many studies have confirmed that NF-κB is closely related to inflammation (McDaniel et al., 2016; Zaidi et al., 2018). The p65/p50 NF-κB usually binds to IκBα and exists in the cytoplasm (McDaniel et al., 2016). In response to an inflammatory reaction, IκBα will be phosphorylated and isolated from the NF-κB subunit. Free NF-κB transported to the nucleus and acted as a transcription factor, eventually leads to the secretion of inflammatory factors such as IL-6, IL-1β and TNF-α (Liang et al., 2018).

Additionally, there is the interaction between inflammatory response and oxidative stress, the role of oxidative stress in uncontrolled inflammatory diseases has been gradually concerned (Tian et al., 2017). Oxidative stress refers to the imbalance of the redox system in the body under the attack of harmful stimulating factors. Excessive reactive oxygen species (ROS) destroy the antioxidant function and lead to the inflammatory response (Newsholme et al., 2018; Forrester et al., 2018). Studies have found that Nrf2/ARE signaling pathway is closely related to oxidative stress in sepsis (Li et al., 2018). When oxidative stress occurs, Nrf2 will enter into the nucleus and interact with ARE to regulate the levels of downstream antioxidant genes, including heme oxygenase-1 (HO-1), catalase (CAT) and superoxide dismutase (SOD). Therefore, up-regulation of Nrf2 expression and activation of ARE-related antioxidant protein can improve oxygenation, inhibit oxidative stress response and alleviate sepsis injury(Wu et al., 2020).

Eaglewood, also known as Aquilaria Sinensis (Lour.) Spreng. is a famous traditional Chinese medicine in China. It has the functions of Xiangqi Zhitong, Wenzhong Zhou, Naqi Pingchuan. Clinically, it is commonly used in the treatment of chest and abdominal distension and pain, stomach cold and vomiting hiccup, kidney deficiency and dyspnea, etc. The main active components of Eaglewood are 2-(2-phenylmethyl) chromones and sesquiterpenes. Many studies have found eaglewood extract has anti-inflammatory and antioxidant effects (Zhou et al., 2008; Lin et al., 2013). Baimuxinol (BAI) is a sesquiterpenoid compound isolated from agarwood. However, as far as we know, there are very limited studies on the pharmacological effects of BAI.

Therefore, in the present study, we aimed to explore the effects of BAI on the proliferation and levels of inflammatory factors and antioxidant-related indexes of RAW264.7 cells stimulated by LPS. We hypothesized that BAI may alleviate LPS induced inflammation and oxidative stress via regulating the NF-κB/IκBα and Nrf2/ARE signaling pathway.

Material and method

Cell culture

RAW264.7 cells from leukemic mice were provided by the cell bank of Shanghai Chinese Academy of Sciences and cultured in high glucose DMEM medium containing 20% fetal bovine serum. 1% penicillin-streptomycin double-antibody was added to the medium. Then the cells were digested with 0.25% trypsin EDTA, passaged in 1:2, and cultured in a 5% CO2 incubator at 37°C.

Groups

The cells were divided into Control group (CON), Lipopolysaccharide group (LPS, cultured with 50 mg/L LPS), Low baimuxinol group (L+BAI, cultured with 50 mg/L LPS+10 nM baimuxinol), Middle baimuxinol group (M+BAI, cultured with 50 mg/L LPS+50 nM baimuxinol), High baimuxinol group (H+BAI, cultured with 50 mg/L LPS+100 nM baimuxinol). Then the cells were cultured in a 5% CO2 incubator at 37°C for 24 hours.

MTT

The cells were placed into 96-well plates (2×104 cells/well). The MTT reagent was added to the cells after incubation for 24 h. Then the cells were cultured with dimethyl sulfoxide. Finally, the absorbance was measured at 490 nm by a microplate reader.

5-ethynyl-2-deoxyuridine (EdU) Assay

The trypsin was added to the logarithmic phase cells, and resuspended in a complete medium to obtain cell suspensions, then the cells were placed into a 96-well plate (2×104 cells/well) and cultured at 37°C in an atmosphere of 5% CO2, with the cell concentration adjusted to 2000 cells/well. The proliferation ability was measured with a Cell-Light EdU DNA Cell Proliferation Kit (RiboBio, Guangzhou, China) according to the instructions of the manufacturer.

Determination of inflammatory factors antioxidant related indexes

The contents of tumor necrosis factor α (TNF-α), interleukin 1β (IL-1β), interleukin 6 (IL-6), malondialdehyde (MDA), 8-hydroxy-2’-deoxyguanosine (8-OHdG), protein carbonyl (PC) and ROS, and CAT and total superoxide dismutase (T-SOD) activities of the cells were determined by the corresponding kits provided by Nanjing Jiangcheng Bioengineering Institute (Nanjing, China).

Quantitative real-time polymerase chain reaction
(qRT-PCR)

The RNA was extracted with TRIzol® (Thermo Fisher Scientific, MA, USA). The transcript RT Kit (TIANGEN Biotech, Beijing, China) was conducted to reverse the RNA to cDNA. The mRNA expressions of the target genes were determined with a miScript SYBR Green PCR Kit (Qiagen, Germany) on a 7900 Real-Time PCR System. Reaction conditions: 95°C, 30 s; 95°C, 5 s, 40 cycles; 60°C, 30 s; 95°C, 15 s; 60°C, 30; 95°C, 15 s. The 2−ΔΔCt method was performed to analyze the relative mRNA expressions. GAPDH was selected as the housekeeping gene. The primers used for qPCR were as follows: IL-6, For: TCCAGTTGCCTTCTTGGGAC, Rev: AGA-CAGGTCTGTTGGGAGTG; IL-1β, For: GAAATGCCACCTTTTGACAGTG and Rev: TGGATGCTCTCATCAGGACAG; TNF-α, For: AGCCGATGGGTTGTACCTTG, Rev: ATAGCAAATCGGCTGACGGT.

Western blot

The protein of the cells was lysed with RIPA buffer (Beyotime Biotechnology), and the concentration was detected using the BCA method (Beyotime Biotechnology). The protein samples (give concentration=20μg) were separated by 12% SDS-PAGE, transferred to the PVDF membrane (Millipore) and blocked in TBS (50 mmol/l Tris-HCL [PH7.6], 150mmol/l NaCl) containing 0.1% Tween-20 (TBS-T) and 5% non-fat milk powder for 2 hr. Then the PVDF membranes were incubated with the primary antibody (Nrf2, 1:1000 dilution; HO-1, 1:1000 dilution; NF-κB, 1:1000 dilution; p-NF-κB, 1:1000 dilution; IκBα, 1:1000 dilution; p-IκBα, 1:1000 dilution;GAPDH, 1:500 dilution; Abcam Trading Co. Ltd., Shanghai) at 4°C overnight. The incubation product was further incubated with a secondary antibody (1:2000 dilution) for 1.5h. Finally, the blot was colored with ECL, and then exposed by LAS4000 chemiluminescence imaging analyzer for gray analysis.

Statistical analysis

All data were expressed as mean ± S.D. SPSS22.0 software was performed for statistical analyses. One way analysis of variance (ANOVA) with a Tukey’s post hoc test was used for comparison among groups. P<0.05 indicated significant difference.

Results

BAI suppressed the viability of the RAW264.7 cells

First, we determined the effect of BAI on the viability of the RAW264.7 cells. The molecular structure of CEP was shown in Fig. 1A. Compared with the CON group, the viability of the cells in the LPS group was significantly increased. After BAI treatment, the viability of the cells was dramatically decreased (Fig. 1B). In addition, the proliferation of the cells was significantly increased after LPS treatment and BAI inhibited the growth of the cells in a dose-dependent manner (Fig. 1C–D).

BAI decreased the levels of inflammatory factors in the RAW264.7 cells

To accurately explore the role of the BAI on the inflammatory response. We analyzed the TNF-α, IL-1β and IL-6 levels of the cells. As shown in Fig. 2, in the LPS group, the levels of TNF-α, IL-1β and IL-6 were markedly up-regulated in comparison with the CON group. In comparison with the LPS group, the TNF-α, IL-1β and IL-6 levels were markedly decreased in L-BAI, M-BAI and H-BAI groups in a dose-dependent manner.

BAI relieved the oxidative stress of the RAW264.7 cells

Subsequently, we explore the effects of BAI on the antioxidant capacity of the RAW264.7 cells. As shown in Fig. 3, in the LPS group, the concentrations of the ROS, MDA, PC and 8-OHdG were dramatically up-regulated, and the T-SOD and CAT activities were significantly down-regulated in comparison with the control group. BAI reversed the effects of LPS on the levels of ROS, MDA, PC, 8-OHdG, T-SOD and CAT in a dose-dependent manner.

BAI suppressed the NF-κB/IκBα signaling pathway

Next, we analyzed the role of BAI in mRNA expressions of inflammatory factors and NF-κB/IκBα signaling pathway. In the LPS group. the mRNA expressions of TNF-α, IL-1β and IL-6 were markedly up-regulated in comparison with the control group. Compared with the LPS group, the TNF-α, IL-1β and IL-6 mRNA expressions were markedly down-regulated in L-BAI, M-BAI and H-BAI groups in a dose-dependent manner (Fig. 4A). In addition, in comparison with the control group, the protein expressions of p-NF-κB and p-IκBα in the LPS group were markedly up-regulated. BAI treatment significantly down-regulated the protein expressions of p-NF-κB and p-IκBα in a dose-dependent manner (Fig. 4B–D).

BAI suppressed the Nrf2/ARE signaling pathway

Finally, the role of BAI in the Nrf2/ARE signaling pathway was explored. We found the mRNA expressions of Nrf2, HO-1, CAT and SOD1 were significantly decreased after LPS treatment, while BAI significantly increased the Nrf2, HO-1, CAT and SOD1 mRNA expressions in a dose-dependent manner (Fig. 5A). Additionally, the protein expressions of Nrf2 and HO-1 were increased in the LPS group in comparison with the control group. BAI markedly up-regulated the protein expressions of Nrf2 and HO-1 (Fig. 5B–D).

Discussion

At present, the theory of uncontrolled inflammatory response and oxidative stress are major factors for the pathogenesis of sepsis. In the current study, we found BAI can reverse the excessive proliferation of RAW264.7 cells caused by LPS. Additionally, BAI could relieve inflammation and oxidative stress by regulating the
NF-κB/IκBα and Nrf2/ARE signaling pathway.

Macrophages is one of the main cells that participated in inflammation. Stimulated by LPS, macrophages could induce the secretion of inflammatory factors, such as IL-1β, IL-6, TNF-α and so on, and then produce a clinical inflammatory response (Cotran et al., 1999). Excessive inflammation is the major factor in many chronic diseases, including autoimmune diseases and neurodegenerative diseases. Therefore, inhibition of excessive inflammatory response is an effective method for the therapy of chronic diseases (Tabas et al., 2013). TNF-α and IL-1β are the initiating factors in inflammatory mediators cascade reaction (Johnson et al., 2015). Among them, TNF-α is a pro-inflammatory cytokine in regulating immune cells. It can induce fever and apoptosis by producing IL-1β and IL-6 and then induce inflammation. The abnormal content of TNF-α leads to the occurrence of many diseases(Wang et al., 2020; Yosefifard et al., 2019; Johnson et al., 2015). IL-6 is a multifunctional cytokine that regulates immune, inflammatory and other physiological processes (Unver et al., 2018). The expression of IL-6 is positively regulated by LPS and IL-1β. In the present study, we confirmed that BAI decreases the production and mRNA expression of LPS induced pro-inflammatory cytokines (TNF-α, IL-1β and IL-6) in a dose-dependent manner, suggesting BAI has potential anti-inflammatory activity. Previous studies have confirmed that eaglewood or its extract has an anti-inflammatory function. Lin and coworkers found that the ethanol extract of eaglewood leaf has an obvious anti-inflammatory effect on capillary dilation, hyperpermeability, exudation and edema in the early stage of inflammation (Lin et al., 2013). Wu et al. showed that the extract of eaglewood can inhibit inflammation by down-regulating the expression of COX-2 and iNOS in the immune signal pathway (Wu et al., 2012). These results were similar to ours and indicated that the extract of eaglewood has an effective anti-inflammatory effect. Therefore, we speculate that BAI, a sesquiterpenoid isolated from eaglewood, maybe a key anti-inflammatory compound.

To further explore the mechanism of BAI, we analyzed the protein expression of the NF-κB/IκBα signaling pathway. NF-κB is critically the control center to regulate inflammatory response (Tak et al., 2001). NF-κB usually binds to IκB in cells in the form of inactive complexes. Once IκB is degraded, NF-κB dimer will transfer to the nucleus and start the transcription of the target gene. A previous study has confirmed that NF-κB can mediate the proliferation, differentiation and production of inflammatory factors of various immune cells(Hayden et al., 2011). In this study, the proliferation ability of the cells was dramatically promoted by LPS, and after treatment of BAI, the over-proliferation of macrophages RAW264.7 was decreased. In addition, we found that LPS activates the NF-κB/IκBα signaling pathway and BAI inhibited it in a dose-dependent manner. Our findings indicated that the inhibitory effect of BAI on over-proliferation may be realized by NF-κB/IκBα inhibiting signal pathway. However, the specific mechanism needs to be further explored.

In addition, ROS is an important product of oxidative stress. When the body or cells are stimulated by endogenous or exogenous harmful substances, the antioxidant capacity will be destroyed, which results in a large amount of accumulated ROS and other oxides. Excessive ROS induces cell damage and promotes the occurrence of inflammatory reactions (Bae et al., 2017). On the other hand, inflammatory cells release many active substances in the inflammatory site, which will also lead to the aggravation of oxidative stress (Kumar et al., 2018). In sepsis, a large number of pro-inflammatory factors and the host’s anti-inflammatory factors are released to induce the production of ROS, which leads to the imbalance of oxidation-reduction state in the body, causes oxidative stress reaction, and finally damages tissue cells and organ systems (Prauchner et al., 2017). Previous studies have shown that various plant extracts can relieve oxidative damage in sepsis, such as curcumin (Zhong et al., 2016) resveratrol (Aydin et al., 2016), etc. In the current study, we also confirmed that BAI reduces the excess ROS induced by LPS. Furthermore, excessive ROS can lead to protein, lipid and DNA damage (Aitken, 2017), which was also be confirmed in this study that the MDA, PC and 8-OHdG levels are increased after LPS treatment. It implied that the cells lipid peroxidation, protein and DNA damage occur in the cells. It is worth noting that all these are relieved after BAI treatment. Nrf2/ARE signaling pathway is one of the most important protection systems against oxidative stress. When cells are exposed to oxidative stress, Nrf2 is recognized and combined with the DNA motif (GCTGAGTCA) on ARE, which starts the transcription of antioxidant genes, and then leads to the expression of antioxidants and related enzymes, such as HO-1 (Shaw et al., 2020). Interestingly, we demonstrated that expressions of Nrf2 and HO-1 are up-regulated after BAI treatment, which indicated that BAI may improve the antioxidant function via the Nrf2/ARE signaling pathway.

To sum up, our results confirmed that BAI can effectively alleviate the inflammatory response and oxidative stress induced by LPS through regulating the NF-κB/IκBα and Nrf2/ARE signaling pathway. However, there are some limitations in this paper, such as we do not have in vivo experiments for validation because the conditions do not permit. Also we hope to validate it on multiple cells in future studies. In conclusion, this study is the first to confirm that BAI has antioxidant and anti-inflammatory functions. Our findings provide a theoretical basis for the clinical application of eaglewood and a new method for the treatment of sepsis.

References

Aitken RJ (2017) Reactive oxygen species as mediators of sperm capacitation and pathological damage. Mol Reprod Develop 84: 1039–1052. https://doi.org/10.1002/mrd.22871

Alhashem F, Tiren-Verbeet NL, Alp E, Doganay M (2017) Treatment of sepsis: What is the antibiotic choice in bacteremia due to carbapenem resistant Enterobacteriaceae? World J Clin Cases 5: 324–332. https://doi.org/10.12998/wjcc.v5.i8.324

Arefian H, Heublein S, Scherag A, Brunkhorst FM, Younis MZ, Moerer O, Fischer D, Hartmann M (2017) Hospital-related cost of sepsis: A systematic review. J Infect 4: 107–117. https://doi.org/10.1016/j.jinf.2016.11.006

Aydın S, Şahin TT, Bacanlı M, Taner G, Başaran AA, Aydın M, Başaran N (2016) Resveratrol protects sepsis-induced oxidative DNA damage in liver and kidney of rats. Balkan Med J 33: 594–601. https://doi.org/10.5152/balkanmedj.2016.15516

Bae H, Jeong CH, Cheng WN, Hong K, Seo HG, Han SG (2017) Oxidative stress-induced inflammatory responses and effects of N-acetylcysteine in bovine mammary alveolar cells. J Dairy Res 84: 418–425. https://doi.org/10.1017/S002202991700067X

Cotran RS, Kumar V (1999) Robbins pathologic basis of disease. W.B. Saunders

Dellinger RP, Levy MM, Carlet JM, Bion J, Parker MM, Jaeschke R, Reinhart K, Angus DC, Brun-Buisson C, Beale R, Calandra T, Dhainaut JF, Gerlach H, Harvey M, Marini JJ, Marshall J, Ranieri M, Ramsay G, Sevransky J, Thompson BT, Townsend S, Vender JS, Zimmerman JL, Vincent JL; International Surviving Sepsis Campaign Guidelines Committee; American Association of Critical-Care Nurses; American College of Chest Physicians; American College of Emergency Physicians; Canadian Critical Care Society; European Society of Clinical Microbiology and Infectious Diseases; European Society of Intensive Care Medicine; European Respiratory Society; International Sepsis Forum; Japanese Association for Acute Medicine; Japanese Society of Intensive Care Medicine; Society of Critical Care Medicine; Society of Hospital Medicine; Surgical Infection Society; World Federation of Societies of Intensive and Critical Care Medicine (2008) Surviving Sepsis Campaign: international guidelines for management of severe sepsis and septic shock: 2008. Crit Care Med 36: 296–327. https://doi.org/10.1097/01.CCM.0000298158.12101.41

Forrester SJ, Kikuchi DS, Hernandes MS, Xu Q, Griendling KK (2018) Reactive oxygen species in metabolic and inflammatory signaling. Circ Res 122: 877–902. https://doi.org/10.1161/CIRCRESAHA.117.311401

Hayden MS, Ghosh S (2011) NF-κB in immunobiology. Cell Res 21: 223–244. https://doi.org/10.1038/cr.2011.13

Johnson ZI, Schoepflin ZR, Choi H, Shapiro IM, Risbud MV (2015) Disc in flames: Roles of TNF-α and IL-1β in intervertebral disc degeneration. Eur Cells Mat 30: 104–117. https://doi.org/10.22203/ecm.v030a08

Kumar S, Gupta E, Kaushik S, Kumar SV, Mehta SK, Jyoti A (2018) Evaluation of oxidative stress and antioxidant status: Correlation with the severity of sepsis. Scand J Immunol 87: e12653. https://doi.org/10.1111/sji.12653

Lancaster GI, Langley KG, Berglund NA, Kammoun HL, Reibe S, Estevez E, Weir J, Mellett NA, Pernes G, Conway JRW, Lee MKS, Timpson P, Murphy AJ, Masters SL, Gerondakis S, Bartonicek N, Kaczorowski DC, Dinger ME, Meikle PJ, Bond PJ, Febbraio MA (2018) Evidence that TLR4 is not a receptor for saturated fatty acids but mediates lipid-induced inflammation by reprogramming macrophage metabolism. Cell Metab 27: 1096–1110.e5. https://doi.org/10.1016/j.cmet.2018.03.014 7.

Li Y, Feng Y, Liu X, Li Y, Zhu H, Sun M, Li P, Liu B, Yang H (2021) Songorine promotes cardiac mitochondrial biogenesis via Nrf2 induction during sepsis. Redox Biol 38: 101771. https://doi.org/10.1016/j.redox.2020.101771

Liang H, Yang X, Liu C, Sun Z, Wang X (2018) Effect of NF-kB signaling pathway on the expression of MIF, TNF-α, IL-6 in the regulation of intervertebral disc degeneration. J Musculoskelet Neur Interact 18: 551–556. PMID: 30511959

Lin H, Li H, Mei Q (2013) Comparative study on anti-inflammation activity between chinese eaglewood leaves and chinese eaglewood. Chinese Arch Trad Chinese Med 3: 548–549 (in Chinese). https://doi.org/10.13193/j.archtcm.2013.03.102.linhz.055

McDaniel DK, Eden K, Ringel VM, Allen IC (2016) Emerging roles for noncanonical NF-κB signaling in the modulation of inflammatory bowel disease pathobiology. Inflam Bowel Dis 22: 2265–2279. https://doi.org/10.1097/MIB.0000000000000858

Newsholme P, Cruzat VF, Keane KN, Carlessi R, de Bittencourt PIH (2016) Molecular mechanisms of ROS production and oxidative stress in diabetes. Biochem J 473: 4527–4550. https://doi.org/10.1042/BCJ20160503C

Prauchner CA (2017) Oxidative stress in sepsis: Pathophysiological implications justifying antioxidant co-therapy. Burns 43: 471–485. https://doi.org/10.1016/j.burns.2016.09.023

Shaw P, Chattopadhyay A (2020) Nrf2-ARE signaling in cellular protection: Mechanism of action and the regulatory mechanisms. J Cell Physiol 235: 3119–3130. https://doi.org/10.1002/jcp.29219

Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC (2016) The third international consensus definitions for sepsis and septic shock (Sepsis-3). JAMA 315: 801–810. https://doi.org/10.1001/jama.2016.0287

Tabas I, Glass CK (2013) Anti-inflammatory therapy in chronic disease: challenges and opportunities. Science 39: 166–172. https://doi.org/10.1126/science.1230720

Tak PP, Firestein GS (2001) NF-kappaB: a key role in inflammatory diseases. J Clin Invest 107: 7–11. https://doi.org/10.1172/JCI11830

Tian T, Wang Z, Zhang J (2017) Pathomechanisms of oxidative stress in inflammatory bowel disease and potential antioxidant therapies. Oxid Med Cell Longev 2017: 4535194. https://doi.org/10.1155/2017/4535194

Unver N, McAllister F (2018) IL-6 family cytokines: Key inflammatory mediators as biomarkers and potential therapeutic targets. Cytokine Growth Factor Rev 41: 10–17. https://doi.org/10.1016/j.cytogfr.2018.04.004

Wang Y, Che M, Xin J, Zheng Z, Li J, Zhang S (2020) The role of IL-1β and TNF-α in intervertebral disc degeneration. Biomed Pharmacotherap 131: 110660. https://doi.org/10.1016/j.biopha.2020.110660

Wu Q, Liu LT, Wang XY, Lang ZF, Meng XH, Guo SF, Yan B, Zhan T, Zheng HZ, Wang HW (2020) Lycium barbarum polysaccharides attenuate kidney injury in septic rats by regulating Keap1-Nrf2/ARE pathway. Life Sci 242: 117240. https://doi.org/10.1016/j.lfs.2019.117240

Yosefifard M, Vaezi G, Malekirad AA, Faraji F, Hojati V (2019) A randomized control trial study to determine the effect of melatonin on serum levels of IL-1β and TNF-α in patients with multiple sclerosis. Iran J Allergy Asthma Immunol 8: 649–654. https://doi.org/10.18502/ijaai.v18i6.2177

Zaidi D, Wine E (2018) Regulation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κβ) in inflammatory bowel diseases. Frontiers Pediatr 6: 317. https://doi.org/10.3389/fped.2018.00317 9.

Zampieri FG, Mazza B (2017) Mechanical ventilation in sepsis: A reappraisal. Shock (Augusta, Ga.) 47 (1S Suppl 1): 41–46. https://doi.org/10.1097/SHK.0000000000000702

Zhong W, Qian K, Xiong J, Ma K, Wang A, Zou Y (2016) Curcumin alleviates lipopolysaccharide induced sepsis and liver failure by suppression of oxidative stress-related inflammation via PI3K/AKT and NF-κB related signaling. Biomedi Pharmacother 83: 302–313. https://doi.org/10.1016/j.biopha.2016.06.036

Zhou M, Wang H, Suolangjiba, Kou J, Yu B (2008) Antinociceptive and anti-inflammatory activities of Aquilaria sinensis (Lour.) Gilg. Leaves extract. J Ethnopharmacol 117: 345–350. https://doi.org/10.1016/j.jep.2008.02.005