Regular paper

Molecular cloning of glutathione reductase from Oryza sativa, demonstrating its peroxisomal localization and upregulation by abiotic stresses

Pamela Chanda Roy and Gopal Chowdhary✉

Plant Molecular Biology Laboratory, School of Biotechnology, KIIT, Bhubaneswar-751024, Odisha, India

Abiotic stress is a major constraint on crop productivity and in the agricultural field, multiple abiotic stresses act synchronously leading to substantial damage to plants. A common after-effect of abiotic stress-induced damage in plants is an increased concentration of reactive oxygen species (ROS) leading to oxidative damage. Glutathione reductase (GR) plays a significant role in curtailing ROS. Apart from the GR enzyme, the peroxisome as an organelle also plays a significant role in ROS homeostasis. Here, we report a peroxisome localized GR, whose expression was found to be upregulated by various abiotic stresses. The in silico analysis also revealed that the peroxisomal localization of GR could be a common phenomenon in angiosperms, suggesting that it could be a suitable candidate against abiotic stress combinations.

Keywords: glutathione reductase, abiotic stress, stress combination, peroxisome, PTS

Received: 26 July, 2022; revised: 01 December, 2022; accepted:
05 December, 2022; available on-line: 08 January, 2023

✉e-mail: gkchowdhary@kiitbiotech.ac.in

Acknowledgments of Financial Support: The financial support from the Science and Engineering and Research Board (SERB), Govt of India, and KIIT University is acknowledged.

Abbreviations: At, Arabidopsis thaliana; BLAST, basic local alignment search tool; CaMV, cauliflower mosaic virus; CT, cycle threshold; EYFP, enhanced yellow fluorescent protein; GR, Glutathione reductase; HT, high temperature; LT, low temperature; PCR, polymerase chain reaction; NCBI, National Center for Biotechnology Information; Os, Oryza sativa; PEX, Peroxin; PTS, peroxisomal targeting signal; ROS, reactive oxygen species; TAIR, The Arabidopsis Information Resource

Introduction

Abiotic stress is one of the significant factors which limits the yield of crops. Due to the untimely onset of abiotic stress conditions, crops worth millions of dollars are lost annually worldwide (Wang et al., 2003; Wania et al., 2016). Abiotic stress leads to a series of detrimental activities in the plant, which cause either partial or complete loss of yield (Yousuf et al., 2012; Harshavardhan et al., 2017). One such after-effect is an increase in the cellular concentration of reactive oxygen species (ROS), which has been observed as a common phenomenon in the case of all types of abiotic stresses. Uncontrolled increase and accumulation of ROS can lead to oxidative damage to the cell, such as oxidation of nucleic acids, protein denaturation, breakdown of cell and organelle membrane, lipid peroxidation, and carbohydrate oxidation (Scandalios, 1993; Noctor & Foyer, 1998). This imbalance in the redox state of the cell is dangerous and could be lethal if left unchecked. ROS also plays a significant role in regulating the response of plants, against environmental stimuli by a redox-dependent reprogramming of signalling pathways (Harshavardhan et al., 2017), thereby making ROS not only an oxidative deterrent but also a signalling molecule (Mittler et al., 2004; Miller et al., 2010). Hence, a delicate balance between ROS production and scavenging needs to be maintained, making ROS homeostasis very crucial. To defend themselves from this abiotic stress-induced oxidative damage, plants have developed various mechanisms. One such mechanism is the glutathione reductase (GR) mediated ascorbate-glutathione pathway, also known as the Foyer-Halliwell-Asada pathway (Asada, 2006; Foyer & Noctor, 2011). In plant cells, GR activity has primarily been found in the chloroplast (70–80%) with a minor presence in mitochondria and cytosol (Edwards et al., 1990; Creissen et al., 1994). However, with recent development in molecular and proteomic techniques, the peroxisomal localization of Arabidopsis thaliana GR has also been demonstrated (Kataya & Reumann, 2010). Also, it is pertinent to mention that the peroxisomes in association with chloroplast and mitochondria are primarily responsible for cellular ROS homeostasis (Foyer & Noctor, 2003; Habib et al., 2016; Dietz et al., 2016; Huang et al., 2016). The significant role of peroxisomes in ROS scavenging and abiotic stress tolerance makes a peroxisome-localized GR of special significance.

Peroxisomes are small, single membrane-bound organelles whose proteome is encoded by nuclear genes, synthesized on cytosolic ribosomes, and imported in a signal-dependent manner (Hu et al., 2012; Emmanouilidis et al., 2016). Depending upon the protein location, peroxisomal proteins could be divided into two broad categories- peroxisomal membrane and matrix proteins, both of which are imported in entirely different manners. GR happens to be a peroxisomal matrix protein (Kataya & Reumann, 2010). The peroxisomal matrix proteins are largely imported either by peroxisomal targeting signal (PTS) type one or PTS type two (Gould et al., 1987; Swinkels et al., 1991). The bulk of the matrix proteins is imported by PTS type 1 while a comparatively smaller number of matrix proteins are imported by PTS type 2 (Brocard & Hartig, 2006; Lazarow, 2006). After being synthesized on cytosolic ribosomes, PTS1 and PTS2 containing proteins are recognized by their respective cytosolic receptors, PEX (peroxin) 5 and PEX7 respectively, which ultimately bring them to peroxisome with the help of other PEX proteins (Kunze, 2019; Kim & Hettema, 2015; Kunze et al., 2011; Kiel et al., 2009; Niederhoff et al., 2005; Reumann, 2004; Bottger et al., 2000; Lametschwandtner et al., 1998; Albertini et al., 1997). The PTS1 is located at the C-terminus of protein and is primarily represented by the last three amino acids, however, the upstream residues also play a significant role in PEX5 binding (Neuberger et al., 2003; Brocard & Hartig, 2006; Lingner et al., 2011; Lametschwandtner et al., 1998; Reumann, 2004; Fodor et al., 2012; 2015), while the PTS2 is located at N-terminus, represented by a nonapeptide (Petriv et al., 2004; Lazarow, 2006). It has also been observed that depending upon the composition of amino acids present at the C-terminus, the PTS1 shows a varying degree of efficiency in peroxisome targeting (Gatto et al., 2000; Stanley et al., 2006) and this has led to the classification of PTS1 into a canonical and noncanonical type (Skoulding et al., 2015). The canonical ones lead to efficient and strong targeting while the non-canonical ones are comparatively less efficient and lead to weak targeting of the protein to the peroxisome. The strong and weak efficiencies have been explained based on the time required for the fluorescent detection of the peroxisome targeting under in vitro conditions (Skoulding et al., 2015; Chowdhary et al., 2012).

In this work, we reported the peroxisome localization of GR and its involvement in abiotic stress tolerance in the monocot model plant Oryza sativa (rice) which is a crop of global significance and is responsible for feeding more than half of the world’s population, especially in Asian, African continents, and other third world nations.

MATERIALS AND METHODS

Data retrieval for in silico work

The protein sequences of A. thaliana and O. sativa GR were retrieved from The Arabidopsis Information Resource (TAIR, Tanya et al., 2015, https://www.arabidopsis.org/) and the rice genome annotation database (Kawahara et al., 2013, http://rice.uga.edu/) respectively. For multiple sequence alignment, CLUSTAL W 2.1 program (Larkin et al., 2007) was used at pir.georgetown.edu (Cathy et al., 2003). The OsGR was used as a query in protein BLAST at NCBI and 80 GR orthologs were obtained.

Plant material and growth condition

For all experiments, O. sativa IR 64 (Indica rice) variety was used. This is an abiotic stress-sensitive variety. The seeds were obtained from National Rice Research Institute, Cuttack, India. The seeds were sterilized with 70% ethanol for 2 min followed by rinsing with distilled water three times each for 2 min. The sterilized seeds were kept in germination paper pre-wet with distilled water, which was incubated in dark for 24 h followed by shifting to the plant growth room maintained at 28±2ºC, 60% humidity, and a light/dark cycle of 16/8 h. For all experimentation, 11 days old seedlings were used. The abiotic stresses were induced by treatment with 200 mM sodium chloride (saline stress), 4±2°C (cold stress), and 45±2°C (heat stress) for 2 h. The untreated seedlings served as a control and were used for the calculation of the relative transcript level of OsGR.

RNA extraction and cloning of OsGR

For RNA extraction, 100 mg of seedling was used and crushed in liquid nitrogen followed by extraction using RNeasy plant mini kit (Qiagen) as per the manufacturer’s protocol, with the modification of inclusion of in-column DNase digestion step (RNase free DNase set, Qiagen). The extracted RNA was checked for its quantity and quality using a microvolume spectrophotometer (ThermoFisher Scientific) and agarose gel electrophoresis.

The extracted RNA was converted to cDNA using Revert Aid First Strand cDNA Synthesis Kit (ThermoFisher Scientific) as per the manufacturer’s manual. The obtained cDNA was used for polymerase chain reaction (PCR) amplification using the primers: Forward AATTGCGGCCGCGATGGCTAGGAAGATGCTCAAG, Reverse TATGTCTAGAGCTACAAGTTTGTCTTTGGCTTGGATGATGG, using HiFidelity polymerase (Qiagen), with PCR cycle of denaturation 94ºC for 20 s, annealing 60ºC for 30 s and extension 72ºC for 90 s. The obtained PCR product was checked for amplification using agarose gel electrophoresis followed by digestion using NotI and XbaI restriction enzymes. The digested product was resolved in an agarose gel followed by gel purification using the GenJET gel extraction kit (ThermoFisher Scientific). The digested product was cloned into the pCAT plant expression vector, as an enhanced yellow fluorescent protein (EYFP) fusion product under the control of a double 35 S cauliflower mosaic virus (CaMV) promoter (Fulda et al., 2002). The insert was verified using automated DNA sequencing.

Subcellular localization of OsGR

For subcellular localization studies, the biolistic bombardment method was used, in which onion epidermal cells were transformed with plasmid constructs coated on gold particles, which were further examined under a fluorescent microscope after an appropriate incubation time. Under standard conditions, the transformed onion epidermal cells are examined after 18–24 h post-transformation. However, it has also been observed that the sensitivity of detection of the reporter protein in peroxisome increases after an extended incubation time at reduced temperature (Lingner et al., 2011, Chowdhary et al., 2012).

The gene of interest (OsGR) was cloned as an EYFP fusion product and as a peroxisomal marker, Ds-Red-SKL was used (Matre et al., 2009). In the case of single transformation experiments pCAT plasmid containing EYFP-OsGR was coated with gold particles, while in the case of double transformation experiments pCAT plasmid containing EYFP-OsGR and peroxisomal marker (Ds-Red-SKL) together were coated with gold particles and bombarded to onion epidermal cells (Ma et al., 2006). The onion slices were placed on wet blotting paper in Petri dishes and stored at room temperature in the dark followed by analysis using fluorescent microscopy or after additional incubation at 10°C for 1 to 6 d. Image capture and analysis were done as explained in Chowdhary et al., (2012).

Expression analysis by real-time PCR

The expression analysis of peroxisomal GR was carried out by real-time PCR technique using SYBR green chemistry. For this, the total RNA was extracted from stress-treated and control (untreated) plants as explained above, its concentration was determined, equalized, and converted to cDNA using high-capacity cDNA reverse transcription kit (ThermoFisher Scientific) as per the manufacturer’s manual. Total RNA, 1 µg, was converted to cDNA, which was diluted and further used for quantitative real-time PCR using SYBR green chemistry. Real-time PCR was performed using QuantiNova 2X PCR master mix containing SYBR green dye with ROX as passive reference dye (Qiagen) in QuantStudio 5 (ThermoFisher Scientific) real-time PCR machine. The conditions for real-time PCR were as follows: initial denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 60 s, and 72°C for 60 s. To obtain the melting curve a program of 95°C for 15 s and 60°C for 1 min was followed. All qPCR analyses were performed in three biological replicates. O. sativa actin was used as an endogenous control for the normalization of the transcript. The relative transcript level or “fold change” (degree of change in expression between the treated sample and untreated sample) was calculated by the ∆∆CT method using the formula, relative transcript level/fold change = 2-∆∆CT, where ΔΔCT = ΔCT test sample – ΔCT calibrator sample (ΔCT test sample = CT test – CT reference, ΔCT calibrator = CT calibrator – CT reference; test sample = stress treated sample, calibrator = untreated sample, reference = endogenous control) (Livak & Schmittgen, 2001). The data provided represents an average of three biological replicates of independent samples and the values depicted represent mean ± standard deviation. The primer used for expression analysis were, OsGR Forward primer – CGACCTTTGACAGCACTGTTGG, reverse primer – TGGTCAAGGTCCGCATTGTCAC, OsActin forward primers – CAGCCACACTGTCCCCATCTA, Reverse primer – AGCAAGGTCGAGACGAAGGA.

Results

Bioinformatics analysis of OsGR

The protein sequence of A. thaliana and O. sativa GR were aligned using CLUSTAL W 2.1 and the alignment revealed the significant conservation among both sequences (Fig. 1). The peroxisome targeting of A. thaliana GR is dependent on the PTS type 1, which is localized at the C-terminus of the protein. In the case of AtGR the PTS1 is represented by TNL> (Kataya & Reumann, 2010, the symbol “>” represents the end of the polypeptide). The presence of the same tripeptide in O. sativa GR provided a hint for peroxisomal localization of OsGR via PTS1 (Fig. 1). Hence, OsGR was fused at the C-terminus of the EYFP, so that the targeting signal is freely available for the cytosolic receptor, PEX5 binding followed by peroxisome targeting (Fig. 1).

Molecular cloning and subcellular localization of OsGR

The cDNA of the O. sativa was used as a template for PCR-based cloning of GR. The primer sequences and PCR cycle are explained in the materials and method section. The PCR amplified product was found to be of 1500 bp and was cloned in the pCAT vector under the control of a double 35 S CaMV promoter. The gene was cloned as a C-terminal fusion of enhanced yellow fluorescent protein (EYFP, Fig. 1). The sequence of the cloned gene was verified using automated DNA sequencing. No mutations were detected.

Onion epidermal cells transformed with EYFP, which served as a negative control showed uniform cytosolic fluorescence (Fig. 2A). The OsGR, which was expressed as a fusion protein with EYFP, showed green cytosolic fluorescence after 24 h of incubation (Fig. 2B1), however the same was observed in small punctuate structures after an extended time of incubation (Fig. 2B2). The identity of fluorescing punctuate structures was confirmed by double transformation experiments co-expressing peroxisomal marker DsRed-SKL. The double transformation experiments demonstrated the overlapping of both green and red fluorescence from EYFP and peroxisomal marker respectively, (Fig. 2C), confirming the identity of the punctuate fluorescing organelle to be peroxisome. Since fluorescence could not be detected in peroxisome 24 h post-transformation and it took an extended time of incubation for the fluorescence to be detected in peroxisome it was presumed that the GR is targeted to peroxisome with lesser efficiency and hence the PTS1 present in GR was termed as weak or non-canonical PTS1.

Expression analysis of OsGR

For OsGR gene expression analysis, the abiotic stress-treated seedlings were used for RNA extraction, followed by cDNA synthesis and real-time PCR. The untreated seedlings were used as a control. The expression data were represented as relative transcript level or “fold change” which essentially means the change in the degree of expression between the treated sample and untreated samples. The details are explained in the materials and method section. Expression analysis was performed with respect to heat, cold, and salinity (sodium chloride) stresses. All the treatments were provided for 2 h. In the case of heat stress, the change in the transcript accumulation was observed to a tune of 3.1-fold (Fig. 3), meaning that GR gene transcripts accumulated 3.1 times more in the heat stress as compared to untreated samples. This was followed by cold and saline stress with transcript level accumulation of about 3.7 and 10.4-fold respectively (Fig. 3). This demonstrated that the expression of peroxisomal localized GR in O. sativa upregulated in the presence of heat, cold, and salinity stress conditions.

Discussion

Abiotic stress is the major bottleneck in the sustainability of the global agricultural system. The harmful effect of abiotic stress is further compounded when more than one abiotic stress factor negatively affects the plant in synchrony, which is more often the case in field conditions. This phenomenon has been termed stress combinations (Zandalinas et al. 2020; 2021) or stress matrix (Mittler, 2006). This necessitates the development of crop varieties that would be tolerant to multiple abiotic stresses. Hence, candidate genes are required which would be effective against most if not all the abiotic stresses. Since the production of ROS is a common factor among all abiotic stresses, we intend to investigate the problem of abiotic stress combinations from the perspective of ROS homeostasis.

Since, peroxisomes play a significant role in cellular ROS homeostasis, a peroxisome-localized candidate participating in ROS homeostasis would be of greater significance. Using in vitro subcellular localization techniques, we reported a GR isoform from Oryza sativa to be localized in peroxisomes. Previously, Kataya & Reumann, (2010) have reported the localization of A. thaliana GR in peroxisomes. The peroxisome targeting of GR is mediated via a non-canonical type of PTS1. The PTS1 tripeptide of GR is represented by TNL> in both A. thaliana (Kataya & Reunann, 2010) and O. sativa. In the case of non-canonical PTS1, the seven upstream residues also play a significant role in binding with the cytosolic receptor PEX5 (Fodor et al., 2012; Brocard & Hartig, 2006; Lingner et al., 2011), which is represented by SPSSKPKTNL> and AHKPKPKTNL> (underlined residues PTS1 tripeptide, others, seven upstream residues) in the case of O. sativa and A. thaliana respectively. Being a non-canonical type of PTS1, the targeting is not very efficient and requires an extended incubation time for the fluorescence to be detected in the peroxisome (Lingner et al., 2011; Chowdhary et al., 2012). To further understand the peroxisome targeting signal of GRs in angiosperms we obtained GR protein sequences from 80 plant species, and the last ten amino acids were aligned by multiple sequence alignment (Supplementary Fig. 1 at https://ojs.ptbioch.edu.pl/index.php/abp/). The alignment revealed that all the sequences were terminating with TNL> suggesting that the presence of a peroxisomal GR could be a common feature among angiosperms. At the -4 position, all the 80 GR orthologs have lysine while at the -5 position 73 sequences have proline except six sequences, one each from Elaeis guineensis, Gossypium hirsutum, Gossypium Raimondi, Amborella trichopoda, Cinnamomum micranthum, and Phoenix dactylifera have alanine and one sequence namely Brachypodium distachyon had leucine. At the -6 position, 75 sequences had lysine while asparagine was present at four places (one sequence each from Citrus clementina, Olea europaea and two sequences from Citrus sinensis) and glutamine was present at one place (Phoenix dactylifera). The most favourable amino acid at the -7 position is glycine which is present in 35 sequences followed by serine present in 29 sequences. At -8, -9 and -10 positions variability increases. The analysis curtailed here reveals that the consensus PTS1 sequence for peroxisomal GRs present in the angiosperms would be [G/S/T/N/A/V] [L/N/Q] [P/A/L] [K] [T] [N] [L]> at -7, -6, -5, -4, -3, -2 and -1> positions, respectively. Figure 4 demonstrates the diagrammatic representation of the propensity of specific amino acids to remain present at specific positions.

Further, the expression pattern of peroxisomal GR was investigated under various abiotic stress conditions. It was found to be upregulated upon heat, cold, and salinity stress in increasing order. GR expression has been reported to get affected due to stress conditions in various plant species, however, all previous reports are of either chloroplastic or cytosolic variants. Salinity and drought stress-dependent upregulation of GR has been demonstrated in Cicer arietinum and O. sativa respectively (Yousuf et al., 2012). A positive correlation between tolerance to low temperature (LT)-induced photoinhibition and high GR activities has been observed in O. sativa (Guo et al., 2006; Huang & Guo, 2005), C. sativus (Hu et al., 2008), (Xu et al., 2008), Glycine max (Sun et al., 2011), Cucumis melo (Fogelman et al., 2011) and Citrullus lanatus (Gill et al., 2013). Increased GR activity has been widely observed in plant species like T. aestivum (Hasanuzzaman et al., 2012), Z. mays (Kumar et al., 2012), Cucumis sativus (Dai et al., 2012), N. tabacum (Tan et al., 2011) and Phaseolus aureus (Kumar et al., 2011) under high temperature (HT) stress. Thus, the upregulation in the expression of GR is postulated to play an important role in plant protection against various forms of abiotic stresses (Trivedi et al., 2013; Gullner et al., 2001; Reisinger et al., 2008).

The overexpression of enzymes of the ascorbate-glutathione (AsA-GSH) pathway has been demonstrated to confer abiotic stress tolerance in plants by reducing the stress-induced cellular reactive oxygen species (ROS). The work has been critically reviewed by Hasanuzzaman et al., (2019). It has been observed that in Vigna radiata (Nahar et al., 2016) and Solanum lycoperisum (Sabeeha et al., 2022), the upregulation of AsA-GSH cycle components leads to saline stress and heavy metal (mercury) stress tolerance, respectively. The overexpression of AsA-GSH enzymes from Pennisetum glaucoma in S. lycopersicum has been reported to be responsible for the reduced accumulation of malondialdehyde and H2O2 (Raja et al., 2022). The impairment of AsA-GSH cycle enzymes has been demonstrated to increase saline stress sensitivity in A. thaliana (Huang et al., 2005). Further, the overexpression of Malpighia glabra monodehydroascorbate reductase (MDHAR) leads to saline stress tolerance in Nicotiana tabacum (Eltelib et al., 2012). The transgenic O. sativa plants overexpressing MDHAR from Acanthus ebracteatus were found to demonstrate enhanced saline tolerance (Sultana et al., 2012). The overexpression of MDHAR and dehydroascorbate reductase (DHAR) in N. tabacum (Eltayeb et al., 2007) and A. thaliana (Ushimaru et al., 2006) have been demonstrated to increase saline stress tolerance. The overexpression of APX has been demonstrated to reduce the toxic effects of stress-induced H2O2 and enhance salinity tolerance in N. tabacum (Badawi et al., 2004). Similarly, the overexpression of APX in N. tabacum has been demonstrated to relieve it from high and low-temperature stress (Yabuta et al., 2002).

It has also been suggested that different GR isoforms can be stimulated by varied environmental signals and can have different functional manifestations in the response to stress in plants (Stevens et al., 1997). This further supports our analysis that a peroxisomal localized GR could have a more pronounced effect in imparting ROS scavenging properties to plants and hence providing better abiotic stress tolerance. It is also pertinent to mention here that ample literature is available about chloroplastic and cytosolic forms while no work has yet been reported on peroxisomal GR. This would be the first report of a full-length GR to be localized in peroxisome from a monocot plant and its involvement in abiotic stress tolerance. Since both peroxisome and GR are the key entities in cellular ROS homeostasis, a peroxisome localized GR would be of much significance in contributing to the abiotic stress tolerance in plants. The in silico analysis also revealed that the peroxisomal localization of GR could be a universal feature among angiosperms. Further, we also reported that the GR was induced by multiple abiotic stress conditions, suggesting that this could also be effective in providing stress tolerance under stress combination or stress matrix situations as well, however, further studies need to be done in this regard.

Conclusion

In the nutshell, we reported a peroxisome localized GR from the monocot model plant Oryza sativa. The in silico analysis also revealed that the peroxisomal localization of GR could be a common feature amongst angiosperms. The peroxisome localized GR was also found to be induced by multiple abiotic stress conditions. The role of GR in ROS homeostasis combined with its peroxisome localization and induction by multiple abiotic stress conditions suggests that it could be a prime candidate for the development of tolerance against abiotic stress combinations.

Declarations

Conflict of interests. The authors confirm that there are no conflicts of interest.

REFERENCES

Albertini M, Rehling P, Erdmann R, Girzalsky W, Kiel JA, Veenhuis M, Kunau WH (1997) Pex14p, a peroxisomal membrane protein binding both receptors of the two PTS-dependent import pathways. Cell 89: 83–92. https://doi.org/10.1016/s0092-8674(00)80185-3

Asada K (2006) Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol 141: 391–396. https://doi.org/10.1104/pp.106.082040

Badawi GH, Kawano N, Yamauchi Y, Shimada E, Sasaki R, Kubo A, Tanaka K (2004) Over−expression of ascorbate peroxidase in tobacco chloroplasts enhances the tolerance to salt stress and water deficit. Physiol Plant 121: 231–238. https://doi.org/10.1111/j.0031-9317.2004.00308.x

Bottger G, Barnett P, Klein AJ, Kragt A, Tabak HF, Distel B (2000) Saccharomyces cerevisiae PTS1 receptor Pex5p interacts with the SH3 domain of the peroxisomal membrane protein Pex13p in an unconventional, non-PXXP–related manner. Mol Biol Cell 11: 3963–3976. https://doi.org/10.1091/mbc.11.11.3963

Brocard C, Hartig A (2006) Peroxisome targeting signal 1: Is it really a simple tripeptide? Biochim Biophys Acta - Mol Cell Res 1763: 1565–1573. https://doi.org/10.1016/j.bbamcr.2006.08.022

Cathy HW, Lai-Su LY, Hongzhan H, Leslie A, Jorge CA, Yongxing C, Zhang-Zhi H, Robert SZ, Panagiotis K, Baris ES, Vinayaka CR, Jian Z, Winona CB (2003) The Protein Information Resource. Nucleic Acids Res 31: 345–347. https://doi.org/10.1093/nar/gkg040

Chowdhary G, Kataya ARA, Lingner T, Reumann, S (2012) Non-canonical peroxisome targeting signals: identification of novel PTS1 tripeptides and characterization of enhancer elements by computational permutation analysis. BMC Plant Biol 12: 142. https://doi.org/10.1186/1471-2229-12-142

Creissen GP, Broadbent P, Kular B, Reynolds H, Wellburn AR, Mullineaux PM (1994) Manipulation of glu­tathione reductase in transgenic plants: implications for plant responses to environmental stress. Proc R Soc Edinb 102B: 167–175. https://doi.org/10.1017/S0269727000014081

Dai AH, Nie YX, Yu B, Li Q, Lu LY, Bai JG (2012) Cinnamic acid pre-treatment enhances heat tolerance of cucumber leaves through modulating antioxidant enzyme activity. Environ Exp Bot 79: 1–10. https://doi.org/10.1016/j.envexpbot.2012.01.003

Dietz KJ, Turkan I, Krieger-Liszkay A (2016) Redox and reactive oxygen species-dependent signaling into and out of the photosynthesizing chloroplast. Plant Physiol 171: 1541–1550. https://doi.org/10.1104/pp.16.00375

Edwards EA, Rawsthorne S, Mullineaux PM (1990) Subcellular distribution of multiple forms of gluta­thione reductase in leaves of pea (Pisum sativum L.). Planta 180: 278–284. https://doi.org/10.1007/BF00194008

Eltayeb AE, Kawano N, Badawi GH, Kaminaka H, Sanekata T, Shibahara T, Inanaga S, Tanaka K (2007) Overexpression of monodehydroascorbate reductase in transgenic tobacco confers enhanced tolerance to ozone, salt and polyethylene glycol stresses. Planta 225: 1255–1264. https://doi.org/10.1007/s00425-006-0417-7

Eltelib HA, Fujikawa Y, Esaka M (2012) Overexpression of the acerola (Malpighia glabra) monodehydroascorbate reductase gene in transgenic tobacco plants results in increased ascorbate levels and enhanced tolerance to salt stress. S Afr J Bot 78: 295–301. https://doi.org/10.1016/j.sajb.2011.08.005

Emmanouilidis L, Gopalswamy M, Passon DM, Wilmanns M, Sattler M (2016) Structural biology of the import pathways of peroxisomal matrix proteins. Biochim Biophys Acta - Mol Cell Res 1863: 804–813. https://doi.org/10.1016/j.bbamcr.2015.09.034

Fodor K, Wolf J, Reglinski K, Passon DM, Lou Y, Schliebs W, Erdmann R, Wilmanns M (2015). Ligand-induced compaction of the PEX5 receptor-binding cavity impacts protein import efficiency into peroxisomes. Traffic 16: 85–98. https://doi.org/10.1111/tra.12238

Fodor K, Wolf J, Erdmann R, Schliebs W, Wilmanns, M (2012) Molecular requirements for peroxisomal targeting of alanine-glyoxylate aminotransferase as an essential determinant in primary hyperoxaluria type 1. PLoS Biol 10: e1001309. doi:10.1371/journal.pbio.10013

Fogelman E, Kaplan A, Tanami Z, Ginzberg I (2011) Antioxidative activity associated with chilling injury tolerance of muskmelon (Cucumis melo L.) rind. Sci Hortic 128: 267–273. https://doi.org/10.1016/j.scienta.2011.01.034

Foyer CH, Noctor G (2003) Redox sensing and signalling associated with reactive oxygen in chloroplasts, peroxisomes and mitochondria. Physiol Plant 119: 355–364. https://doi.org/10.1034/j.1399-3054.2003.00223.x

Foyer CH, Noctor G (2011) Ascorbate and glutathione: the heart of the redox hub. Plant Physiol 155: 2–18. https://doi.org/10.1104/pp.110.167569

Fulda M, Shockey J, Werber M, Wolter FP, Heinz E (2002) Two long-chain acyl-CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid beta-oxidation. Plant J 32: 93–103. https://doi.org/10.1046/j.1365-313X.2002.01405.x

Gatto G, Geisbrecht B, Gould S, Berg J (2000) Peroxisomal targeting signal-1 recognition by the TPR domains of human PEX5. Nat Struct Mol Biol 7: 1091–1095. https://doi.org/rg/10.1038/81930

Gill SS, Anjum NA, Hasanuzzaman M, Gill R, Trivedi DK, Ahmad I, Pereira E, Tuteja N (2013) Glutathione and glutathione reductase: a boon in disguise for plant abiotic stress defense operations. Plant Physiol Biochem 70: 204–212. https://doi.org/10.1016/j.plaphy.2013.05.032

Gould SG, Keller GA, Subramani S (1987) Identification of a peroxisomal targeting signal at the carboxy terminus of firefly luciferase. J Cell Biol 105: 2923–2931. https://doi.org/10.1083/jcb.105.6.2923

Gullner G, Kömives T, Rennenberg H (2001) Enhanced tolerance of transgenic poplar plants overexpressing g-glutamyl cysteine synthetase towards chloroacetanilide herbicides. J Exp Bot 52: 971–979. https://doi.org/10.1093/jexbot/52.358.971

Guo Z, Ou W, Lu S, Zhong Q (2006) Differential responses of antioxidative system to chilling and drought in four rice cultivars differing in sensitivity. Plant Physiol Biochem 44: 828e836. https://doi.org/10.1016/j.plaphy.2006.10.024

Habib SH, Kausar H, Saud HM (2016) Plant growth-promoting rhizobacteria enhance salinity stress tolerance in okra through ROS-scavenging enzymes. BioMed Res Int 6284547. https://doi.org/10.1155/2016/6284547

Hasanuzzaman M, Bhuyan MHM, Borhannuddin A, Taufika I, Parvin K, Nahar K, Mahmud JA, Fujita M (2019) Regulation of ascorbate-glutathione pathway in mitigating oxidative damage in plants under abiotic stress. Antioxidants 8: 384. https://doi.org/10.3390/antiox8090384

Harshavardhan VT, Wu TM, Hong CY (2017) Glutathione reductase and abiotic stress tolerance in plants, pp 265–286. Springer International Publishing AG. https://doi.org/10.1007/978-3-319-66682-2_12

Hasanuzzaman M, Nahar K, Alam MM, Fujita M (2012) Exogenous nitric oxide alleviates high temperature induced oxidative stress in wheat (Triticum aestivum) seedlings by modulating the antioxidant defense and glyoxalase system. Aust J Crop Sci 6: 1314–1323. https://search.informit.org/doi/10.3316/informit.732190847330318

Hu J, Baker A, Bartel B, Linka N, Mullen RT, Reumann S, Zolman BK (2012) Plant Peroxisomes: Biogenesis and Function. The Plant Cell Preview 24: 2279–2303. https://doi.org/10.1105/tpc.112.096586

Hu W, Song X, Shi K, Xia X, Zhou Y, Yu J (2008) Changes in electron transport, superoxide dismutase and ascorbate peroxidase isoenzymes in chloroplasts and mitochondria of cucumber leaves as influenced by chilling. Photosynthetica 46: 581–588. https://doi.org/10.1007/s11099-008-0098-5

Huang C, He W, Guo J, Chang X, Su P, Zhang L (2005) Increased sensitivity to salt stress in an ascorbate–deficient Arabidopsis mutant. J Exp Bot 56: 3041–3049. https://doi.org/10.1093/jxb/eri301

Huang M, Guo Z (2005) Responses of antioxidative system to chilling stress in two rice cultivars differing in sensitivity. Biol Plant 49: 81–84. https://doi.org/10.1007/s00000-005-1084-3

Huang S, Van Aken O, Schwarzlander M, Belt K, Millar AH (2016) The roles of mitochondrial reactive oxygen species in cellular signaling and stress response in plants. Plant Physiol 171: 1551–1559. https://doi.org/10.1104/pp.16.00166

Kataya AR, Reumann S (2010) Arabidopsis glutathione reductase 1 is dually targeted to peroxisomes and the cytosol. Plant Signal Behav 5: 171–175. https://doi.org/10.4161/psb.5.2.10527

Kawahara Y, de la Bastide M, Hamilton JP, Kanamori H, McCombie WR, Ouyang S, Schwartz DC, Tanaka T, Wu J, Zhou S, Childs KL, Davidson RM, Lin H, Quesada-Ocampo L, Vaillancourt B, Sakai H, Lee SS, Kim J, Numa H, Itoh T, Buell CR, Matsumoto T (2013) Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice 6: 4. https://doi.org/10.1186/1939-8433-6-4

Kiel JA, van den Berg MA, Fusetti F, Poolman B, Bovenberg R., Veenhuis M, van der Klei IJ (2009) Matching the proteome to the genome: the microbody of penicillin-producing Penicillium chrysogenum cells. Funct Integr Genomics 9: 167–184. https://doi.org/10.1007/s10142-009-0110-6

Kim PK, Hettema EH (2015) Multiple pathways for protein transport to peroxisomes. J Mol Biol 427: 1176–1190. https://doi.org/10.1016/j.jmb.2015.02.005

Kumar S, Gupta D, Nayyar H (2012) Comparative response of maize and rice genotypes to heat stress: status of oxidative stress and antioxidants. Acta Physiol Plant 34: 75–86. https://doi.org/10.1007/s11738-011-0806-9

Kumar S, Kaur R, Kaur N, Bhandhari K, Kaushal N, Gupta K, Bains T, Nayyar H (2011) Heat-stress induced inhibition in growth and chlorosis in mung bean (Phaseolus aureus Roxb.) is partly mitigated by ascorbic acid application and is related to reduction in oxidative stress. Acta Physiol Plant 33: 2091–2101. https://doi.org/10.1007/s11738-011-0748-2

Kunze M (2019) The type-2 peroxisomal targeting signal. Biochim. Biophys. Acta Mol Cell Res 1867: 118609. https://doi.org/10.1016/j.bbamcr.2019.118609

Kunze M, Neuberger G, Maurer-Stroh S, Ma J, Eck T, Braverman N, Schmid JA, Eisenhaber F, Berger J (2011) Structural requirements for interaction of peroxisomal targeting signal 2 and its receptor PEX7. J Biol Chem 286: 45048–45062. https://doi.org/10.1074/jbc.M111.301853

Lametschwandtner G, Brocard C, Fransen M, Van Veldhoven P, Berger J, Hartig A (1998) The difference in recognition of terminal tripeptides as peroxisomal targeting signal I between yeast and human is due to different affinities of their receptor Pex5p to the cognate signal and to residues adjacent to it. J Biol Chem 273: 33635–33643. https://doi.org/10.1074/jbc.273.50.33635

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics. 23: 2947–2948. https://doi.org/10.1093/bioinformatics/btm404

Lazarow PB (2006) The import receptor Pex7p and the PTS2 targeting sequence. Biochim Biophys Acta - Mol Cell Res 1763: 1599–1604. https://doi.org/10.1016/j.bbamcr

Lingner T, Kataya AR, Antonicelli GE, Benichou A, Nilssen K, Chen XY, Siemsen T, Morgenstern B, Meinicke P, Reumann S (2011) Identification of novel plant peroxisomal targeting signals by a combination of machine learning methods and in vivo subcellular targeting analyses. Plant Cell 23: 1556–1572. https://doi.org/10.1105/tpc.111.084095

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using Real-Time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25: 402–408. https://doi.org/10.1006/meth.2001.1262

Ma C, Haslbeck M, Babujee L, Jahn O, Reumann S (2006) Identification and characterization of a stress-inducible and a constitutive small heat-shock protein targeted to the matrix of plant peroxisomes. Plant Physiol 141: 47–60. https://doi.org/10.1104/pp.105.073841

Matre P, Meyer C, Lillo C (2009) Diversity in subcellular targeting of the PP2A B’eta subfamily members. Planta 230: 935–945. https://doi.org/10.1007/s00425-009-0998-z

Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ 33: 453–467. https://doi.org/10.1111/j.1365-3040.2009.02041.x

Mittler R (2006) Abiotic stress, the field environment and stress combination. Trends Plant Sci 11: 15–19. https://doi.org/10.1016/j.tplants.2005.11.002

Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of plants. Trend Plant Sci 9: 490–498. https://doi.org/10.1016/j.tplants.2004.08.009

Nahar K, Rahman M, Hasanuzzaman M, Alam MM, Rahman A, Suzuki T, Fujita M (2016) Physiological and biochemical mechanisms of spermine-induced cadmium stress tolerance in mung bean (Vigna radiata L.) seedlings. Environ Sci Pollut Res Int 21: 21206–21218. https://doi.org/10.1007/s11356-016-7295-8

Neuberger G, Maurer-Stroh S, Eisenhaber B, Hartig A, Eisenhaber F (2003) Prediction of peroxisomal targeting signal 1 containing proteins from amino acid sequence. J Mol Biol 328: 581–592. https://doi.org/10.1016/S0022-2836(03)00319-X

Niederhoff K, Meindl-Beinker NM, Kerssen D, Perband U, Schäfer A, Schliebs W, Kunau W (2005) Yeast Pex14p possesses two functionally distinct Pex5p and one Pex7p binding sites. J Biol Chem 280: 35571–35578. https://doi.org/10.1074/jbc.M502460200

Noctor G, Foyer CH (1998) Ascorbate and Glutathione: Keeping Active Oxygen Under Control. Annu Rev Plant Physiol Plant Mol Biol 49: 249–279. https://doi.org/10.1146/annurev.arplant.49.1.249

Petriv OI, Tang L, Titorenko VI, Rachubinski RA (2004) A new definition for the consensus sequence of the peroxisome targeting signal type 2. J Mol Biol 341: 119–134. https://doi.org/10.1016/j.jmb.2004.05.064

Raja V, Wani UM, Wani ZA, Jan N, Kottakota C, Reddy M, Kaul T, John R (2022) Pyramiding ascorbate–glutathione pathway in Lycopersicum esculentum confers tolerance to drought and salinity stress. Plant Cell Rep 41: 619–637. https://doi.org/10.1007/s00299-021-02764-8

Reisinger S, Schiavon M, Terry N, Smits EAP (2008) Heavy metal tolerance and accumulation in Indian mustard (Brassica juncea L.) expressing bacterial g-glutamylcysteine synthetase or glutathione synthetase. Int J Phytorem 10: 440–454. https://doi.org/10.1080/15226510802100630

Reumann S (2004) Specification of the peroxisome targeting signals type 1 and type 2 of plant peroxisomes by bioinformatics analyses. Plant Physiol 135: 783–800. https://doi.org/10.1104/pp.103.035584

Sabeeha B, Nelofer J, Umer MW, Vaseem R, Riffat J (2022) Co-over expression of Ascorbate Glutathione pathway enzymes improve mercury tolerance in tomato. Plant Physiol Biochem 186: 170–181. https://doi.org/10.1016/j.plaphy.2022.07.015

Scandalios JG (1993) Oxygen stress and superoxide dismutases. Plant Physiol. 101: 7–12. https://doi.org/10.1104/pp.101.1.7

Skoulding NS, Chowdhary G, Deus MJ, Baker A, Reumann S, Warriner SL (2015) Experimental validation of plant peroxisomal targeting prediction algorithms by systematic comparison of in vivo import efficiency and in vitro PTS1 binding affinity. J Mol Biol 427: 1085–1101. https://doi.org/10.1016/j.jmb.2014.12.003

Stanley WA, Filipp FV, Kursula P, Schüller N, Erdmann R, Schliebs W, Sattler M, Wilmanns M (2006) Recognition of a functional peroxisome type 1 target by the dynamic import receptor pex5p. Mol Cell 24: 653–663. https://doi.org/10.1016/j.molcel.2006.10.024

Stevens RG, Creissen GP, Mullineaux PM (1997) Cloning and characterization of a cytosolic glutathione reductase cDNA from pea (Pisum sativum L.) and its expression in response to stress. Plant Mol Biol 35: 641–654. https://doi.org/10.1023/A:1005858120232

Sultana S, Khew CY, Morshed MM, Namasivayam P, Napis S, Ho CL (2012) Over-expression of monodehydroascorbate reductase from a mangrove plant (AeMDHAR) confers salt tolerance on rice. J Plant Physiol 169: 311–318. https://doi.org/10.1016/j.jplph.2011.09.004

Sun H, Li L, Wang X, Wu S, Wang X (2011) Ascorbate-glutathione cycle of mitochondria in osmoprimed soybean cotyledons in response to imbibitional chilling injury. J Plant Physiol 168: 226–232. https://doi.org/10.1016/j.jplph.2010.07.017

Swinkels BW, Gould SJ, Bodnar AG, Rachubinski RA, Subramani S (1991) A novel, cleavable peroxisomal targeting signal at the amino-terminus of the rat 3- ketoacyl-CoA thiolase. Embo J 10: 3255–3262. https://doi.org/10.1002/j.1460-2075.1991.tb04889.x

Tan W, Brestic M, Olsovska K, Yang X (2011) Photosynthesis is improved by exogenous calcium in heat-stressed tobacco plants. J Plant Physiol 168: 2063–2071. https://doi.org/10.1016/j.jplph.2011.06.009

Tanya ZB, Leonore R, Donghui L, Yarik M, Robert M, Emily S, Eva H (2015) The Arabidopsis Information Resource: Making and mining the “gold standard” annotated reference plant genome. Genesis 53: 474–485. https://doi.org/10.1002/dvg.22877

Trivedi D, Gill SS, Yadav S, Tuteja S (2013) Genome-wide analysis of glutathione reductase (GR) genes from rice and Arabidopsis. Plant Signal Behav 8: 0e1. https://doi.org/10.4161/psb.23021

Ushimaru T, Nakagawa T, Fujioka Y, Daicho K, Naito M, Yamauchi Y, Nonaka H, Amako K, Yamawaki K, Murata N (2006) Transgenic Arabidopsis plants expressing the rice dehydroascorbate reductase gene are resistant to salt stress. J Plant Physiol 163: 1179–1184. https://doi.org/10.1016/j.jplph.2005.10.002

Wang W, Vinocur B, Altman A (2003) Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 28: 1–14. https://doi.org/10.1007/s00425-003-1105-5

Wania SH, Kumar V, Shriram V, Sah SK (2016) Phytohormones and their metabolic engineering for abiotic stress tolerance in crop plants. Crop J 4: 162–176. https://doi.org/10.1016/j.cj.2016.01.010

Xu PL, Guo YK, Bai JG, Shang L, Wang XJ (2008) Effects of long-term chilling on ultrastructure and antioxidant activity in leaves of two cucumber cultivars under low light. Physiol Plant 132: 467–478. https://doi.org/10.1111/j.1399-3054.2007.01036.x

Yabuta Y, Motoki T, Yoshimura K, Takeda T, Ishikawa T, Shigeoka S (2002) Thylakoid membrane-bound ascorbate peroxidase is a limiting factor of antioxidative systems under photo-oxidative stress. Plant J 32: 915–925. https://doi.org/10.1046/j.1365-313x.2002.01476.x

Yousuf PY, Hakeem KUR, Chandna R, Ahmad P (2012) Role of Glutathione Reductase in Plant Abiotic Stress, pp 149–158. Springer Science. https://doi.org/10.1007/978-1-4614-0634-1_8.

Zandalinas SI, Fritschi FB, Mittler R (2020) Signal transduction networks during stress combination. J Exp Bot 71: 1734–1741. https://doi.org/10.1093/jxb/erz486

Zandalinas SI, Soham S, Felix BF, Rajeev KA, Rachel N, Ron M (2021) The impact of multifactorial stress combination on plant growth and survival. New Phytol 230: 1034–1048. https://doi.org/10.1111/nph.17232